Indian Patents. 265261:"RECOMBINANTLY PREPARED POLYPEPTIDE FROM H. INFLUENZAE AND COMPOSITION THEREOF" (2024)

Title of InventionAbstractPolypeptides comprising non-typeable Haemophilus influenzae (NTHi) amino acid sequences.Over 2500 specific NTHi proteins are disclosed.The invention also provides related polypeptides nucleic acids,antibodies and methods.These can all be used in medicine for treating or preventing disease and/or infection caused by H.influenzae such as otitis media.
Full TextWO 2005/111066PCT/IB2005/001775
POLYPEPTEDES FROM NON-TYPEABLE HAEMOPHILUS INFLUENZAE
All documents cited herein are incorporated by reference in their entirety
TECHNICAL FIELD
This invention is in the field of Haemophilus influenzae immunology and vaccinology
BACKGROUND ART
Haemophilus influenzae is a small, non-motile, Gram-negative coccobacillus It is a respiratory pathogen that causes a wide spectruin of human infections, including asymptomatic colonization of the upper respiratory tract (i e carnage), infections that extend from colonized mucosal surfaces to cause otitis media (inflammation of the middle ear), bronchitis, conjunctivitis sinusitis, urinary tract infections and pneumonia, and invasive infections, such as bacterernia, septic arthritis, epiglottitis, pneumonia, empyema, pericarditis cellulitis, osteomyelitis and meningitis H. influenzae was the first bacterium for which a complete genome sequence was published [1]
H.influenzae strains are either capsulated (typeable) or non-capsulated (non-typeabJe) and there are six major serological types of capsulated strains (a to f) 95% of H influenzae-caused invasive diseases are caused by H influenzae type b ('Hib ) strains The most serious manifestation of Hib disease is meningitis but the introduction in the 1980s of vaccines based on conjugated Hib capsular saccharides has hugely reduced incidence of this disease
Although Hib infections can now be controlled by vaccination, other pathogenic H.influenzae strains remain a risk For instance, non-typeabJe H influenzae (NTHi) is responsible for otitis media (OM), particularly chronic OM While OM is rarely associated with mortality, it is associated with significant morbidity Hearing loss is the most common complication of OM, with behavioral educational and language development delays being additional consequences of early onset OM with effusion Acute OM is the most common bacterial infection in children in the USA The non-typeable H influenzae biogroup aegyptius causes epidemic conjunctivitis and Brazilian purpunc fever (BPP) [2], with BPF having a mortality of up to 70%
To date, antibiotics are the mam tool against the spectrum of clinical entities known collectively as OM but widespread use of antibiotics for OM has met with controversy due to the emergence of multiple-antibiotic resistant microorganisms Progress towards a vaccine is slow due to an incomplete understanding of both the pathogenesis of OM and the immune response to it
The genome sequence of the serotype d strain KW20 [1,3] has been useful for understanding basic H.influenzae biology, but it has not been so useful in countering pathogenic H.influenzae strains as serotype d strains are generally not pathogens
It is an object of the invention to provide polypeptides for use in the development of vaccines for preventing and/or treating infections caused by non-typcable H.influenzae strains In particular, it is an object to provide polypeptides for use in improved vaccines for preventing and/or treating otitis media The polypeptides may also be useful for diagnostic purposes, and as targets for antibiotics
-I-

WO 2005/111066PCT/IB2005/001775
DISCLOSURE OF THE INVENTION
Polypeptides
The invention provides polypeptides comprising the H influenzae amino acid sequences disclosed in the examples These amino acid sequences are the even SEQ ID NOs between 2 and 5080 There are thus 2540 amino acid sequences, and these are referred to as NTHnnnn, where nnnn is a number between 0001 and 2832 (there are 292 NTHnnnn numbers that have no sequence, see Table I) Further NTHi sequences of the invention are given as SEQ ID NOS 5088 onwards
The invention also provides polypeptides comprising amino acid sequences thathave sequence identity to the H influenzae amino acid sequences disclosed in the examples Depending on the particular sequence, the degree of sequence identity is preferably greater than 50% (eg 60%, 70%, 75% 80% 85% 90% 91% 92% 93% 94% 95%, 96% 97% 98%, 99% or more) These polypeptides include hom*ologs, orthologs allelic variants and functional mutants Typically 50% identity or more between two polypeptide sequences is considered to be an indication of functional equivalence Identity between polypeptides is preferably determined by the Smith-Waterman hom*ology search algorithm as implemented in the MPSRCH program (Oxford Molecular), using an affine gap search with parameters gap open penalty~12 and gap extension penalty=1
These polypeptide may, compared to the NTHi sequences of the examples, include one or more (e g 1,2,3,4,5,6,7 8,9 10 etc) conservative amino acid replacements i e replacements of one amino acid with another which has a related side chain Genetically-encoded amino acids are generally divided into four families (1) acidic ie aspartate glutamate, (2) basic i. e lysine, arginine, histidine, (3) non polar i. e. alanine valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan, and (4) uncharged polar i e glycine, asparagine, glutamme, cystine, serine, threonine, tyrosme Phenylalanine, tryptophan, and tyrosine are sometimes classified jointly as aromatic amino acids In general, substitution of single amino acids within these families does not have a major effect on the biological activity The polypeptides may also include one or more (eg 1 2 3 4, 5, 6, 7 8, 9 10, etc ) single amino acid deletions relative to the NTHi sequences of the examples The polypeptides may also include one or more (e g 1,2, 3 4, 5, 6,7 8 9, 10 etc ) insertions (e g each of 1,2, 3,4 or 5 amino acids) relative to the NTHi sequences of the examples
Preferred poljpeptides of the invention are listed in Table II, including polypeptides that are lipidated, that are located in the outer membrane, that are located in the innei membrane, that ate located in the penplasm, or that are not found in non-pathogenic H. influenzae strains Particularly preferred polypeptides ate those that fall into more than one of these categories e g polypeptides that aic located in the outer membrane and are also not found in non-pathogenic H.influenzae strains
A particularly preferred polypeptide is NTH0867 NTH0S61 NTH0863 and NTH0865 are also preferred As described below, these four proteins are embodied by SEQ ID NOS 1566, 5095, 1570 5094, 1574,5903, 1578 and 5092 Within these eight SEQ ID NOS, 1566-1578 are preferred
-2-

WO 2005/111066PCT/IB205/00I775
The invention further provides polypeptides comprising fragments of the H.influenzae amino acid sequences disclosed in the examples The fragments should comprise at least n consecutive amino acids from the sequences and, depending on the particular sequence, n is 7 or more (eg 8 10, 12 14, 16, 18, 20 22,24 26,28 30,35 40,45 50 60,70, 80, 90,100 ormore)
The fragment may comprise at least one T cell or preferably, a B-cell epitope of the sequence T-and B-cell eprtopes can be identified empirically (e g using PEPSCAN [4,5] or similar methods), or they can be predicted (e g using the Jameson-Wolf antigenic index [6], matrix-based approaches [7], TEPITOPE [8], neural networks [9] OptiMer & EpiMer [10, 11] ADEPT [12], Tsites [13], hydrophilicity [14], antigemc index [15] or the methods disclosed in reference 16 etc) Other preferred fragments are (a) the N-termtnal signal peptides of the NTHi polypeptides of the invention, (b) the NTHi polypeptides, but without their N-terminal signal peptides, (c) the NTHi polypepbdes but without their N-termmal amino acid residue
Polypeptides of the invention can be prepared in many ways e g by chemical synthesis (in whole or in part), by digesting longer polypeptides using proteases, by translation from RNA by purification from cell culture (eg from recombwant expression), from the organism itself (eg after bacterial culture, or direct from patients), etc A preferred method for production of peptides Polypeptides of the invention can take various forms (eg native, fusions, glycosylated, non-glycos>lated hpidated, non-hpidated, phosphorylated, non-phosphorylated, myristoylated, non-mynstoylated, monomeric, multimeric, particulate, denatured, etc)
Polypeptides of the invention are preferably provided in purified or substantially purified form i e substantially free from other polypeptides {eg free from naturally-occurring polypept.des), particularly from other Haemophilvs or host cell polypeptides, and are generally at least about 50% pure (by weight) and usually at least about 90% pure i e less than about 50%, and more preferably less than about 10% (eg 5%) of a composition is made up of other expressed polypept.des Polypeptides of the invention are preferably H influenzas polypeptides Polypeptides of the invention preferably have the function indicated in Table III for the relevant sequence
-3

WO 2005/111066PCT7IB2005/001775
Polypeptides of the invention may be attached to a solid support Polypeptides of the invention may comprise a detectable label (eg a. ladioactive or fluorescent label, or a biotin label)
The term "polypeptide" refers to amino acid polymers of any length The polymer may be linear or branched, it may comprise modified amino acids and it may be interrupted by non-amino acids The terms also encompass an amino acid polymer that has been modified naturally or by intervention, for example, disulfide bond formation glycosylation, lipidation acetylation, phosphorylation, or any other manipulation or modification such as conjugation with a labeling component Also included within the definition are for example polypeptides containing one or more analogs of an amino acid (including, for example, unnatural amino acids, etc ), as well as other modifications known in the art. Polypeptides can occui as single chains or associated chains Polypeptides of the invention can be naturally or non-naturally glycosylated (i e the polypeptide has a glycosylation pattern that differs from the glycosylation pattern found in the corresponding naturally occurring polypeptide)
The invention provides polypeptides comprising a sequence -X-Y- or -Y-X-, wherein -X- is an amino acid sequence as defined above and -Y- is not a sequence as defined above i e the invention provides fusion proteins Where the N-terminus codon of a polypeptide-coding sequence is not ATG then that codon will be translated as the standard amino acid for that rodon rather than as a Met, which occurs when the codon is a start codon
The invention provides a process for producing polypeptides of the invention, comprising the step of culturing a host cell of to the invention under conditions which induce polypeptide expression
The invention provides a process for producing a polypeptide of the invention, wherein the polypeptide is synthesised in part or in whole using chemical means
The invention provides a composition comprising two or more polypeptides of the invention
The invention also provides a hybrid polypeptide represented by the formula NH2-A-[ X-L-]n-B-COOH, wherein X is a polypeptide of the invention as defined above L is an optional linker amino acid sequence, A is an optional N-terminal amino acid sequence B is an optional C-terminal amino acid sequence, and n is in integer greater than 1 The value of n is between 2 and x, and the value of x is typically 3, 4, 5 6,1 8 9 or 10 Preferably n is 2, 3 or 4, it is more preferably 2 or 3, most preferably, n = 2 For each n instances, -X- may be the same or different For each n instances of [-X-L-], linker amino acid sequence L- may be present or absent Foi instance when n=2 the hybrid may be NH2-X1-L1-X2-L2-COOH, NH2 X,-X2-COOH, NH2-X, L1-X2-COOH, NH2Xi-X2-L2-COOH, etc Linker amino acid sequence(s) -L- wil! typically be short (e g 20 or fewer amino acids i.e 19, 18, 17, 16 15, 14, 13, 12, 11, 10, 9, 8, 7 6 5 4, 3 2 1) Examples include short pcptide sequences which facilitate cloning, poly-glycine linkers (i. e Glyrt where n = 2 3, 4 5 6, 7, 8, 9, 10 01 more) and histidine tags (i. e His,, where in = 3 4, 5 6,7 8, 9, 10 or more) Other suitable linker amino acid sequences will be apparent to those skilled in the art -A- and -B are optional sequences which will typically be short (e g 40 or fewer amino acids i. e 39, 38, 37, 36, 35, 34, 33, 32, 31, 30,

WO 2005/111066PCT/IB2005/001775
29 28, 27 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8 7 6, 5 4 3, 2 1) Examples include leader sequences to direct polypeptide trafficking, or short peptide sequences which facilitate cloning or purification (e g histidine tags / e Hisn where n = 3, 4, 5, 6, 7, 8 9 10 or more) Other suitable N-terminal and C-terminal amino acid sequences will be apparent to those skilled in the art
Various tests can be used to assess the in vivo immunogenicity of polypeptides of the invention For example, polypeptides can be expressed recombinantly and used to screen patient sera by immunoblot A positive reaction between the polypeptide and patient serum indicates that the patient has previously mounted an immune response to the protein in question i e the protein is an immunogen This method can also be used to identify immunodominant proteins
Antibodies
The invention provides antibodies that bind to polypeptides of the invention These may be polyclonal or monoclonal and may be produced by any suitable means {eg by recombinant expression) To increase compatibility with the human immune system, the antibodies may be chimenc or humanised [e g refs 22 & 23], or fully human antibodies may be used The antibodies may include a detectable label (eg for diagnostic assays) Antibodies of the invention may be attached to a solid support Antibodies of the invention are preferably neutralising antibodies
Monoclonal antibodies are particularly useful in identification and purification of the individual polypeptides against which they are directed Monoclonal antibodies of the invention may also be employed as reagents in immunoassays radioimmunoassays (RIA) or enzyme linked immunosorbent assays (ELISA) etc In these applications the antibodies can be labelled with an analytically-deteclable reagent such as a radioisotope a fluorescent molecule or an enzyme The monoclonal antibodies produced by the above method may also be used for the molecular identification and characterization (epitope mapping) oi polypeptides of the invention
Antibodies of the invention arc preferably provided in purified or substantially purified form Typically, the antibody will be present in a composition that is substantially free of other polypeptides e g where less than 90% (by weight), usually less than 60% and more usually less than 50% of the composition is made up of other polypeptides
Antibodies of the invention can be of any isotype (e g IgA, IgG, IgM i e an a, y or u heavy chain) but will generally be IgG Within the IgG isotype antibodies may be IgGl IgG2 IgG3 or IgG4 subclass Antibodies of the invention may have a K or a ? light chain
Antibodies of the invention can take various forms, including whole antibodies, antibody fragments such as F(ab')2 and F(ab) fragments, Tv fragments (non-covalent heterodimers), single-chain antibodies such as single chain F\ molecules (scFv), mimbodies oligobodies etc The term "antibody' does not imply any particular origin and includes antibodies obtained through non-conventional processes such as phage display
-5-

WO 2005/111066PCT/IB2005/001775
The invention provides a process for detecting polypeptides of the invention, comprising the steps of (a) contacting an antibody of the invention with a biological sample under conditions suitable for the formation of an antibody antigen complexes and (b) detecting said complexes
The invention provides a process for detecting antibodies of the invention comprising the steps of (a) contacting a polypeptide of the invention with a biological sample (e g a blood or serum sample) under conditions suitable for the formation of an antibody-antigen complexes, and (b) detecting said complexes
Nucleic acids
The invention provides nucleic acid comprising the H.influenzae nucleotide sequences disclosed in the examples These nucleic acid sequences are the odd SEQ ID NOs between 1 and 50S0
The invention also provides nucleic acid comprising nucleotide sequences having sequence identity to the H influenzae nucleotide sequences disclosed in the examples Identity between sequences is preferably determined by the Smith-Waterman hom*ology search algorithm as described above
The invention also provides nucleic acid which can hybridize to the H.influenzae nucleic acid disclosed in the examples Hybridization reactions can be performed under conditions of different " stringency" Conditions that increase stringency of a hybridization leaction of widely known and published in the art [e g page 7 52 of reference 24] Examples of relevant conditions include (in oidet of increasing stringency) incubation temperatures of 25°C, 37°C, 50°C, 55°C and 68°C buffer concentrations of 10 x SSC, 6 x SSC, 1 x SSC, 0 1 x SSC (where SSC is 0 15 M NaCl and 15 mM citrate buffer) and their equivalents using other buffer systems formamide concentrations of 0%, 25%, 50%, and 75%, incubation times from 5 minutes to 24 hours, 1, 2, or more washing steps wash incubation times of 1 2, or 15 minutes, and wash solutions of 6 x SSC, 1 x SSC, 0 1 x SSC or de-ionized water Hybridization techniques and their optimization are well known in the art [e g see references 24-27, etc ]
In some embodiments nucleic acid of the invention hybridizes to a target of the invention under low stringency conditions, in other embodiments it hybridizes under intermediate stringency conditions in preferred embodiments, it hybridizes under high stringency conditions An exemplary set of low stringency hybridization conditions is 50°C and 10 x SSC An exemplary set of intermediate stringency hybridization conditions is 55°C and 1 xSSC An exemplary set of high stringency hybridization conditions is 68°C and 0 1 x SSC
Nucleic acid comprising fragments of these sequences are also provided These should comprise at least n consecutive nucleotides from the H influenzae sequences and depending on the particular sequence,n is 10 or more (eg 12,14,15 18 20,25 30,35,40 50 60 70,80,90,100 150,200or more)
The invention provides nucleic acid of formula 5-X-Y Z-3' wherein -X- is a nucleotide sequence consisting of x nucleotides -Z- is a nucleotide sequence consisting of z nucleotides, -Y- is a
-6-

WO2005/111066PCT/IB2003/001775
nucleotide sequence consisting of either (a) a fragment of one of the odd-numbered SEQ ID NOS 1 to 5079 or (b) the complement of (a), and said nucleic acid 5' X-Y-Z-31 is neither (i) a fragment of one of the odd-numbered SEQ ID NOS 1 to 5079 nor (u) the complement of (l) The -X- and/or -Z-moieties may comprise a promoter sequence (or its complement)
The invention also provides nucleic acid encoding the polypeptides and polypeptide fragments of the invention
The invention includes nucleic acid comprising sequences complementary to the sequences disclosed in the sequence listing (e g for antisense or probing, or for use as primers), as well as the sequences in the orientation actually shown
Nucleic acids of the invention can be used in hybridisation reactions (e g Northern or Southern blots, or in nucleic acid microarrays or gene chips ) and amplification reactions (eg PCR, SDA, SSSR, LCR, TMA, NASBA etc ) and other nucleic acid techniques
Nucleic acid according to the invention can take various forms (e g single-stranded, double-stranded, vectois, primers, probes, labelled etc) Nucleic acids of the invention may be circular or branched, but will generally be linear Unless otherwise specified or required, any embodiment of the invention that utilizes a nucleic acid may utilize both the double-stranded form and each of two complementary single-stranded forms which make up the double-stranded form Primers and probes are generally single stranded, as are antisense nucleic acids
Nucleic acids of the invention are preferably provided in purified or substantially purified form i. e substantially free from other nucleic acids (eg free from naturally-occurrmg nucleic acids) particularly from other Haemophilus or host cell nucleic acids, generally being at least about 50% pure (by weight), and usually at least about 90% pure Nucleic acids of the invention are preferably H influenzae nucleic acids
Nucleic acids of the invention may be prepared in many ways eg by chemical synthesis (eg phosphoramidite synthesis of DNA) in whole or in part by digesting longer nucleic acids using nucleasesfeg restriction enzymes) by joining shorter nucleic acids or nucleotides (eg using hgases orpolytnerases), from genomic or cDNA hbranes, etc
Nucleic acid of the invention may be attached to a solid support (e g a bead, plate, filter, film, slide, microarray support, resin etc ) Nucleic acid of the invention may be labelled e g with a radioactive or fluorescent label, or a biotin label This is particularly useful where the nucleic acid is to be used in detection techniques e g wheie the nucleic acid is a primer or as a probe
The term 'nucleic acid" includes in general means a polymeric form of nucleotides of any length which contain deoxyribonucleotides, nbonucleotides, and/or their analogs It includes DNA RNA DNA/RNA hybrids It also includes DNA or RNA analogs, such as those containing modified backbones (e g pepttde nucleic acids (PNAs) or phosphorothioates) or modified bases Thus Ihe invention includes mRNA, tRNA, rRNA, ribozymes, DNA, cDNA recombinant nucleic acids
-7-

WO 2005/111066PCT/IB2005/001775
branched nucleic acids, plasmids, vectors, probes, primers, etc Where nucleic acid of the invention takes the form of RNA, it may or may not have a 5' cap
Nucleic acids of the invention comprise NTHi sequences, but they may also comprise non-NTHi sequences (e g in nucleic acids of formula 5-X-Y-Z-3', as defined above) This is particularly useful for primers, which may thus comprise a first sequence complementary to a PCAV nucleic acid target and a second sequence which is not complementary to the nucleic acid target Any such non-complementary sequences in the primer are preferably 51 to the complementary sequences Typical non-complementary sequences comprise restriction sites or promoter sequences
Nucleic acids of the invention can be prepared in many ways e g by chemical synthesis (at least in part)3 by digesting longer nucleic acids using nucleases (e g restriction enzymes), by joining shorter nucleic acids (e g using hgases or polymerases), from genomic or cDNA libraiies, etc
Nucleic acids of the invention may be part of a vector ; e part of a nucleic acid construct designed for transduction/transfection of one or more cell types Vectors may be, for example, 'cloning vectors" which are designed for isolation propagation and replication of inserted nucleotides, "expression vectors" which are designed for expression of a nucleotide sequence in a host cell, "viral vectors" which is designed to result in the production of a recombmant virus or virus-like particle, or "shuttle vectors , which comprise the attributes of more than one type of vector Preferred vectors are plasmids A host cell" includes an individual cell or cell culture which can be or has been a recipient of exogenous nucleic acid Host cells include progeny of a single host cell and the progeny may not necessarily be completely identical (in morphology or in total DNA complement) to the original parent cell due to natural accidental, or deliberate mutation and/or change Host cells include cells tiansfected or infected in vivo or in vitro with nucleic acid of the invention
Where a nucleic acid is DNA, it will be appreciated that "U" in a RNA sequence will be replaced by T" in the DNA Similarly where a nucleic acid is RNA, it will be appreciated that T in a DNA sequence will be replaced by "U" in the RNA
The term "complement" or "complementary" when used in relation to nucleic acids refers to Watson-Crick base pairing Thus the complement of C is G, the complement of G is C, the complement of A is T (or U), and the complement of T (or U) is A. It is also possible to use bases such as I (the punne inosine) e g to complement pyrimidines (C or T) The terms also imply a direction -the complement of 5'-ACAGT-3' is 5'-ACTGT-3 rather than 5' TGTCA-3'
Nucleic acids of the invention can be used, for example to produce polypeptides, as hybridization probes for the detection of nucleic acid in biological samples, to generate additional copies of the nucleic acids, to generate ribozymes or antisense oligonucleotides, as single-stranded DNA primers or probes, or as triple-strand forming ohgonucleotides
The invention provides a process for producing nucleic acid of the invention, wherein the nucleic acid is synthesised in part or in whole using chemical means
-8-

WO 2005/111066PCT/IB2005/001775
The invention provides vectors comprising nucleotide sequences of the invention (e g cloning or expression vectors) and host cells transformed with such vectors
The invention also provides a kit comprising primers (e g PCR primers) for amplifying a template sequence contained within a Haemophilus bacterium (eg E.injluenzae) nucleic acid sequence, the kit comprising a first primer and a second primer, wherein the first primer is substantially complementary to said template sequence and the second primer is substantially complementary to a complement of said template sequence, wherein the parts of said primers which have substantial complementarity define the termini of the template sequence to be amplified The first primer and/or the second primer may include a detectable label (e g a fluorescent label)
The invention also provides a kit comprising first and second single-stranded oligoaucleotidea which allow amplification of a Haemophilus template nucleic acid sequence contained in a single- or double-stranded nucleic acid (or mixture thereof), wherein (a) the first oligonucleotide comprises a primer sequence which is substantially complementary to said template nucleic acid sequence, (b) the second oligonucleotide comprises a primer sequence which is substantially complementary to the complement of said template nucleic acid sequence, (c) the first oligonucleotide and/or the second oligonucleotide comprise(s) sequence which is not compementary to said template nucleic acid, and (d) said primer sequences define the termmi of the template sequence to be amplified The non-complementary sequence(s) of feature (c) are preferably upstream of (; e 5' to) the primer sequences One or both of these (c) sequences may comprise a testnction site [eg ief 28] or a piomoter sequence [e g 29] The first oligonucleotide and/or the second oligonucleotide may include a detectable label (e g a fluorescent label)
The template sequence may be any part of a genome sequence
The invention provides a process for detecting nucleic acid of the invention, comprising the steps of (a) contacting a nucleic probe according to the invention with a biological sample under hybridising conditions to form duplexes, and (b) detecting said duplexes
The invention provides a process for detecting H.influenzae in a biological sample {eg blood), comprising the step of contacting nucleic acid according to the invention with the biological sample under hybridising conditions The process may involve nucleic acid amplification (e g PCR, SDA, SSSR, LCR, TMA, NASBA, etc ) or hybridisation (e g microarrays, blots, hybridisation with a probe in solution etc) PCR detection of H.influenzae in clinical samples has been reported [e g see refs 30 & 31] Clinical assays based on nucleic acid are described in general in ref 32
The invention provides a process for preparing a fragment of a target sequence, wherein the fragment is prepared by extension of a nucleic acid primer The target sequence and/or the primer are nucleic acids of the invention The primer extension reaction may involve nucleic acid amplification (eg PCR, SDA SSSR, LCR, TMA, NASBA etc )
Nucleic acid amplification according to the invention may be quantitative and/or real-time
-9-

WO 2005/111066PCT/IB2005/001775
For certain embodiments of the invention, nucleic acids are preferably at least 7 nucleotides in length (eg 8 9 10 11 12 13,14,15,16,17,18,19,20,21,22 23,24 25,26,27,28,29 30,31,32,33 34, 35, 36, 37, 38, 39, 40, 45, 50, 55, 60, 65, 70, 75 80, 90, 100 110, 120., 130, 140, 150, 160 170, 180, 190,200,225,250,275, 300 nucleotides or longer)
For certain embodiments of the invention, nucleic acids are preferably at most 500 nucleotides in length (e g 450,400, 350,300,250,200, 150, 140, 130, 120, 110, 100, 90, 80, 75 70, 65, 60, 55, 50, 45, 40, 39,38,37, 36, 35, 34, 33, 32, 31, 30,29,28,27, 26, 25, 24, 23,22, 21,20,19,18,17, 16, 15 nucleotides or shorter)
Primers and probes of the invention, and other nucleic acids used for hybridization are preferably between 10 and 30 nucleotides in length (eg- 10,11,12,13,14,15 16,17 18 19 20 21,22,23,24, 25,26 27,28 29, or 30 nucleotides)
Pharmaceutical compositions
The invention provides compositions comprising (a) polypeptide, antibody and/or nucleic acid of the invention and (b) a pharmaceutically acceptable carrier These compositions may be suitable as immunogenic compositions, for instance, or as diagnostic reagents, or as vaccines Vaccines according to the invention may either be prophylactic (i e to prevent infection) or therapeutic (i e to treat infection) but will typically be prophylactic
A 'pharmaceutically acceptable earners includes any carreir that does not itself induce the production of antibodies harmful to the individual receiving the composition Suitable carriers are typically large slowly metabolised macromolecules such as proteins., polysacchandes, polyiactic acids polyglycolic acids, polymeric amino acids, amino acid copolymers sucrose trehalose lactose, and lipid aggregates (such as oil droplets or hposomes) Such carriers are well known to those of ordinary skill in the art The vaccines may also contain diluents, such as water saline glycerol etc Additionally auxiliary substant.es, such as wetting or emulsifying agents, pH buffering substances, and the like, may be present Sterile pyrogen-free, phosphate-buffered physiologic saline is a typical carrier A thorough discussion of phaimaceutically acceptable excipients is available in ref 138
Compositions of the invention may include an antimicrobial, particularly if packaged in a multiple
dose format
Compositions of the invention may compuse detergent e g a Tween (polysoibate), such as Tween
80 Detergents are generally present at low levels e g Compositions of the invention may include sodium salts (e g sodium chloride) to give tonicity A
concentration of 10±2mg/ml NaCI is typical
Compositions of the invention will generally include a buffer A phosphate buffer is typical
Compositions of the invention may comprise a sugar alcohol (eg mannitol) or a disacchande (eg sucrose or trehalose) eg at around l5-30mg/mI (eg 25 mg/ml) particularly if they are to be
-10-

WO2005/111066PCT/IB2005/001775
Iyophilised or if they include matenal which has been reconstituted from Iyophihsed material The pH of a composition for Iyophilisation may be adjusted to around 6 1 prior to lyophilisation
Polypcptides of the invention may be administered in conjunction with other immunoregulatory agents In particular, compositions will usually include a vaccine adjuvant Adjuvants which may be used in compositions of the invention include, but are not limited to
A Mineral-containing compositions
Mineral containing compositions suitable for use as adjuvants in the invention include mineral salts, such as aluminium salts and calcium salts The invention includes mineral salts such as hydroxides (e g oxyhydroxides) phosphates (e g hydroxyphosphates orthophosphates), sulphates, etc [e g see chapters 8 & 9 of ref 33], or mixtures of different mineral compounds with the compounds taking any suitable form (e g gel, crystalline, amorphous, etc), and with adsorption being preferred The mineral containing compositions may also be formulated as a particle of metal salt [34]
Aluminium phosphates are particularly pieferred, particularly in compositions which include a Hinfiuenzae sacchande antigen and a typical adjuvant is amorphous aluminium hydroxyphosphate with PCVA1 molar ratio between 0 84 and 0 92, included at 0 6mg Al37ml Adsorption with a low dose of aluminium phosphate may be used e g between 50 and lOOug A1J+ per conjugate per dose Where there is more than one conjugate in a composition not all conjugates need to be adsorbed
B Oil Emulsions
Oil emulsion compositions suitable for use as adjuvants in the invention include squalenc-water emulsions, such as MF59 [Chapter 10 of ref 33, see also ref 35] (5% Squalene, 0 5% Tween 80, and 0 5% Span 85, fonnulated into submicron particles using a microfluidizer) Complete Freund's adjuvant (CFA) and incomplete Freund's adjuvant (IFA) may also be used
C Saponin formulations [chapter 22 of ref 33]
Saponin formulations may also be used as adjuvants in the invention Saponins are a heterologous group of sterol glycosides and tuterperioid glycosides that are found in the bark, leaves, stems roots and even flowers of a wide lange of plant species Saponin from the bark of the Quillaia saponana Molina tree have been widely studied as adjuvants Saponin can also be commercially obtained from Smilax ornata (sarsaprilla) Gypsophilla pamculata (brides veil), and Saponana officianals (soap root) Saponin adjuvant formulations include purified formulations, such as QS1, as well as hpid formulations, such as ISCOMs QS21 is maiketed as Stimulon(tm)
Saponin compositions have been purified using HPLC and RP-HPLC Specific purified fiactions using these techniques have been identified including QS7 QS17 QS18 QS21, QH-A, QH B and QH-C Preferably the saponin is QS21 A method of production of QS21 is disclosed in ref 36 Saponin formulations may also comprise a sterol such as cholesterol [37]
-11-

WO 2005/111066PCT/IB2005/001775
Combinations of saponins and cholesterols can be used to form unique particles called immunostimulating complexs (ISCOMs) [chapter 23 of ref 33] ISCOMs typically also include a phospholipid such as phosphatidylethanolamine or phosphatidylcholine Any known saponin can be used in ISCOMs Preferably the ISCOM includes one or more of QuilA, QHA & QHC ISCOMs are further described in refs 37-39 Optionally, the ISCOMS may be devoid of additional detergent [40]
A review of the development of saponin based adjuvants can be found in refs 41 & 42
D Virosomes and virus-like particles
Virosomes and virus-like particles (VLPs) can also be used as adjuvants in the invention These structures generally contain one or more proteins from a virus optionally combined or formulated with a phosphohpid They are generally non-pathogenic, non replicating and generally do not contain any of the native viral genome The viral proteins may be recombinantly produced or isolated from whole viruses These viral proteins suitable for use in virosomes or VLPs include proteins derived from influenza virus (such as HA or NA), Hepatitis B virus (such as core or capsid proteins), Hepatitis E virus, measles virus, Smdbis virus Rotavirus, Foot-and-Mouth Disease virus, Retrovirus, Norwalk virus, human Papilloma virus HIV, RNA-phages, QB-phage (such as coat proteins), GA-phage, fi-phage AP205 phage, and Ty (such as retrotiansposon Ty protein p1) VLPs are discussed further in Lefs 43-48 Virosomes are discussed further in, for example, ref 49
E Bacterial or microbial derivatives
Adjuvants suitable for use in the invention include bacterial or microbial derivatives such as
non-toxic derivatives of enterobactenal lipopolysacchande (LPS), Lipid A derivatives immunostimulatory oligonucleotides and ADP nbosylating toxins and detoxified derivatives thereof
Non-toxic derivatives of LPS include monophosphoryl hpid A (MPL) and 3-O-deacylated MPL (3dMPL) 3dMPL is a mixture of 3 de O-acylated monophosphoryl hpid A with 4 5 or 6 acylated chains A preferred small particle" form of 3 De-O-acylated monophosphoryl hpid A is disclosed in ref 50 Such " small particles" of 3dMPL are small enough to be sterile filtered through a 0 22um membrane [50] Other non-toxic LPS derivatives include monophosphoryl lipid A mimics, such as aminoalkyl glucosamimde phosphate derivatives e g RC-529 [51,52]
Lipid A derivatives include derivatives of lipid A from Escherichia coll such as OM-174 OM-174 is described for example in refs 53 & 54
Immunostimulatory ohgonucleotides suitable for use as adjuvants in the invention include nucleotide sequences containing a CpG motif (a dinucleotide sequence containing an unmethylated cytosine linked by a phosphate bond to a guanosine) Double-stranded "RNAs and ohgonucleotides containing palindiomic or poly(dG) sequences have also been shown to be immunostimulatory
The CpG s can include nucleotide modifications/analogs such as phosphorothioate modifications and can be double stranded or single-stranded References 55, 56 and 57 disclose possible analog
-12-

WO 2005/111066PCT/IB2005/001775
substitutions e g replacement of guanosine with 2'-deoxy 7-deazaguanosine The adjuvant effect of CpG oligonucleotides is further discussed in refs 58-63
The CpG sequence may be directed to TLR9, such as the motif GTCGTT or TTCGTT [64] The CpG sequence may be specific for inducing a Th1 immune response, such as a CpG-A ODN, or it may be more specific for inducing a B cell response, such a CpG-B ODN CpG-A and CpG-B ODNs are discussed in refs 65-67 Preferably, the CpG is a CpG-A ODN
Preferably, the CpG oligonucleotide is constructed so that the 5' end is accessible for receptor recognition Optionally, two CpG oligonucleotide sequences may be attached at their 3' ends to form immunomers" See, for example, refs 64 & 68 70
Bacterial ADP-nbosylating toxins and detoxified derivatives thereof may be used as adjuvants in the invention Preferably, the protein is derived from E coh (E coli heat labile enterotoxin "LT"), cholera ("CT"), or pertussis (*TT") The use of detoxified ADP-nbosylating toxins as mucosal adjuvants is described in ref 71 and as parenteral adjuvants in ref 72 The toxin or toxoid is preferably in the form of a holotoxin comprising both A and B subunits Preferably, the A subunit contains a detoxifying mutation preferably the B subunit is not mutated Preferably, the adjuvant is a detoxified LT mutant such as LT-K63, LT-R72, and LT-G192 The use of ADP-nbosylating toxins and detoxified derivaties thereof particularly LT-IC63 and LT-R72, as adjuvants can be found in refs 73-80 Numerical reference for amino acid substitutions is preferably based on the alignments of the A and B subumts of ADP-nbosylating toxins set forth in ref 81 specifically incorporated heiein by reference in its entirety
F Human immunomodulators
Human immunomodulators suitable for use as adjuvants in the invention include cytokines, such as interleukins {eg IL-1 IL-2, IL-4, IL 5 IL-6, DL-7, IL-12 [82], etc) [83], inteiferons {eg interferon-y), macrophage colony stimulating factor and tumor necrosis factor
G Bwadhesives and Mucoadhesives
Bioadhesives and mucoadhesives may also be used as adjuvants in the invention Suitable bioadhesives, include estenfied hyaluronic acid microspheres [84] or mucoadhesives such as cross-linked derivatives of poly(acrylic acid), polyvinyl alcohol polyvmyl pyrolhdone, polysaccharides and carboxymethylcellulose Chitosan and derivatives thereof may also be used as adjuvants in the invention [85]
H Microparticles
Microparticles may also be used as adjuvants in the invention Microparticles (; e a particle of ~100nm to ~150µm in diameter, more preferably ~200nm to ~30µm in diameter, and most preferably ~500nm to -~10µm in diameter) formed from materials that are biodegradable and non-toxic {e g a poly(aFhydroxy acid) a polyhydroxybutyric acid, a polyorthoester, a polyanhydnde a polycaprolactone etc ) with poly(lactide-co-glycohde) are preferred, optionally treated to have a
-13-

WO 2005/111066PCT/lB2005/001775
negatively-charged surface (eg with SDS) or a positively-charged surface (eg with a cationic detergent, such as CTAB)
I Liposomes (Chapters 13 & 14 of ref 33)
Examples of liposome formulations suitable for use as adjuvants are described in refs 86-88
J Polyoxyethylene ether and polyoxyethylene ester formulations
Adjuvants suitable for use in the invention include polyoxyethylene ethers and polyoxyethylene esters [89] Such formulations further include polyoxyethylene sorbitan ester surfactants in combination with an octoxynol [90] as well as polyoxyethylene alkyl ethers or ester surfactants in combination with at least one additional non-ionic surfactant such as an octoxynol [91] Preferred polyoxyethylene ethers are selected from the following group polyoxyethylene-9-lauryl ether (laureth 9), polyoxyethyiene-9-steoryl ether, polyoxytheylene 8 steoryl ether, polyoxyethylene 4-lauryl ether polyoxyethylene-35-lauryl ether, and polyoxyethyIene-23-lauryl ether
K Polyphosphazene (PCPP)
PCPP formulations are described, for example, in refs 92 and 93
L Muramyl peptides
Examples of muramyl peptides suitable for use as adjuvants in the invention include N acetyl-muramyl-L-threonyl-D isoglutamine (tar MDP) N acetyl-normuramyl-L-alanyl D isoglutaminc (nor-MDP) and N acetylmuramyl-L-alanyl D lsoglutarninyl-L-alanine 2-(l -2-dipalmitoyl-s;i glycero-3-hydroxyphosphoryloxy) ethylaimne MTP-PE)
M Imdazoquinolone Compounds
Examples of lmidazoquinolone compounds suitable for use adjuvants in the invention include
Imiquamod and its hom*ologues (e g "Resiquimod 3M"), described further in refs 94 and 95
The invention may also compuse combinations of aspects of one or more ofthe adjuvants identified above Foi example the following adjuvant compositions may be used in the invention (1) a saponm and an oil-in watei emulsion [96] (2) a sapomn (eg QS21) + a non-toxic LPS derivative (eg 3dMPL) [97] (3) a saponm (e g QS21) + a non-toxic LPS derivative (e g 3dMPL) + a cholesterol, (4) a sapomn (e g QS21) + 3dMPL + IL-12 (optionally + a sterol) [98], (5) combinations of 3dMPL with, for example, QS21 and/oi oil-in-water emulsions [99], (6) SAF, containing 10% squalane, 0 4% Tween 80(tm) 5% pluronic-block polymer L121, and thr MDP either microflurdized into a submicron emulsion or vortexed to generate a larger particle size emulsion (7) Ribi adjuvant system (RAS), (Ribi Immunochem) containing 2% squalene, 0 2% Tween 80, and one or more bacterial ceLl wall components from the group consisting of monophosphoryhpid A (MPL), nehalose dimycolate (TDM), and cell wall skeleton (CWS), preferably MPL + CWS (Detox(tm)) and (8) one or more mineral salts (such as an aluminum salt) + a non-toxic derivative of LPS (such as 3dMPL)
Other substances that act as lmmunostimulating agents are disclosed in chapter 7 of ref 33
-14-

WO 2005/111066PCT/IB2005/001775
The use of an aluminium hydroxide or aluminium phosphate adjuvant is particularly preferred, and antigens are generally adsorbed to these salts Calcium phosphate is another preferred adjuvant
The pH of compositions of the invention is preferably between 6 and 8, preferably about 7 Stable pH may be maintained by the use of a buffer Where a composition comprises an aluminium hydroxide salt it is preferred to use a histidine buffer [100] The composition may be sterile and/or pyrogen-free Compositions of the invention may be isotonic with respect to humans
Compositions may "be presented in vials, or they may be presented in ready-filled syringes The syringes may be supplied with or without needles A syringe will include a single dose of the composition, whereas a vial may include a single dose or multiple doses Injectable compositions will usually be liquid solutions or suspensions Alternatively, they may be presented in solid form (e g freeze-dried) for solution or suspension in liquid vehicles prior to injection
Compositions of the invention may be packaged in unit dose form or in multiple dose form For multiple dose forms, vials are preferred to pre-filled syringes Effective dosage volumes can be routinely established, but a typical human dose of the composition for injection has a volume of 0 5ml
Where a composition of the invention is to be prepared extemporaneously prior to use (e g where a component is presented in lyophihsed form) and is presented as a kit, the kit may comprise two vials, or it may comprise one ready-filled syringe and one vial, with the contents of the syringe being used to reactivate the contents of the vial prior to injection
Immunogemc compositions used as vaccines comprise an immunologically effective amount of antigen(s), as well as any other components as needed By'immunologically effective amount' it is meant that the administration of that amount to an individual either in a single dose or as part of a series is effective for treatment or prevention This amount vanes depending upon the health and physical condition of the individual to be treated age, the taxonomic group of individual to be treated (e g non-human primate primate, etc ), the capacity of the individual's immune system to synthesise antibodies the degree of protection desired, the formulation of the vaccine, the treating doctor's assessment of the medical situation, and other relevant factors It is expected that the amount will fall in a relatively broad lange that can be determined through routine trials, and a typical quantity of each meningococcal sacchaude antigen per dose is between 1 µg and 10mg per antigen
Phar maceuttcat uses
The invention also provides a method of treating a patient, comprising administering to the patient a therapeutically effective amount of a composition of the invention The patient may either be at risk from the disease themselves or may be a pregnant woman ( maternal immunisation')
The invention provides nucleic acid, polypeptide of antibody of the invention for use as medicaments (e g as immunogenic compositions or as vaccines) or as diagnostic reagents It also
provides the use of nucleic acid, polypeptide, or antibody of the invention in the manufactuie of (l) a
-15-

WO 2005/111066PCT/IB2005/001775
medicament for treating or preventing disease and/or infection caused by H influenzas, (II)a diagnostic reagent for detecting the presence of H.influenzae or of antibodies raised against H influenze, and/or (III) a reagent which can raise antibodies against H influenzae Said H.influenzae serotype or strain, but is preferably a non-typeable H influenzae Said disease may be for instance otitis media (including acute otttis media), bronchitis, conjunctivitis, sinusitis, a urinary tract infection, pneumonia, bacteremia, septic arthritis epiglottitis pneumonia, empyema, pericarditis, cellulitis, osteomyelitis, lower respiratory tract infection or meningitis The invention is particularly useful for preventing inflammation of the middle ear, by eliciting an immune response that prevents bacteria from moving from the throat to the middle ear via the eustachian tube, where the middle ear is then colonised
The patient is preferably a human Where the vaccine is for prophylactic use, the human is preferably a child (eg a. toddler or infant), where the vaccine is for therapeutic use, the human is preferably an adult A vaccine intended for children may also be administered to adults e g to assess safety dosage, immunogemcity, etc
One way of checking efficacy of therapeutic treatment involves monitoring NTHi infection after administration of the composition of the invention One way of checking efficacy of prophylactic treatment involves monitoring immune lesponses against an administered polypeptide after administration Immunogenicity of compositions of the invention can be determined by administering them to test subjects (eg children 12-16 months age, or animal models [eg a chinchilla model [146]) and then determining standard parameters including ELISA titres (GMT) of IgG These immune lesponses will generally be determined atound 4 weeks after administration of the composition, and compared to values determined before administration of the composition Where more than one dose of the composition is administered, more than one post-administration determination may be made
Administration of polypeptide antigens is a preferred method of treatment for inducing immunity Administration of antibodies of the invention is another preferred method of treatment This method of passive immunisation is particularly useful for newborn children or for pregnant women This method will typically use monoclonal antibodies, which will be humanised or fully human
Compositions of the invention will generally be administered directly to a patient Direct delivery may be accomplished by parenteral injection (eg subcutaneously intrapentoneally intravenously, intramuscularly, of to the interstitial space of a tissue), or by rectal, oral, vagin*l, topical, transdermal, intianasai, ocular, aural, pulmonary or other mucosal administration Intramuscular administration to the thigh or the upper arm is preferred Injection may be via a needle (e g a hypodermic needle), but needle-free injection may alternatively be used A typical intramuscular dose is 0 5 ml The invention may be used to elicit systemic and/or mucosal immunity
-16-

WO 2005/111066PCT/IB2005/001775
Dosage treatment can be a single dose schedule or a multiple dose schedule Multiple doses may be used in a primary immunisation schedule and/or in a booster immunisation schedule A primary dose schedule may be followed by a booster dose schedule Suitable timing between pruning doses (e g between 4 16 weeks), and between priming and boosting, can be routinely determined
Bacterial infections affect various areas of the body and so compositions may be prepared in various forms For example, the compositions may be prepared as injectables, either as liquid solutions or suspensions Solid forms suitable for solution in, or suspension in, liquid vehicles prior to injection can also be prepared (e g a lyophilised composition) The composition may be prepared for topical administration eg as an ointment, cream or powder The composition be prepared for oral administration e g as a tablet or capsule, or as a syrup (optionally flavoured) The composition may be prepared for pulmonary administration eg as an inhaler, using a fine powder or a spray The composition may be prepared as a suppository or pessary The composition may be prepared for nasal, aural or ocular administration eg as spray, drops, gel or powder [e g refs 101 & 102]
Combinations
Within the >2500 proteins described in the examples, NTH0861, NTH0863, NTH0865 and NTH0867 are particularly preferred for use with the invention (particularly in vaccines), and these four proteins can be used in combinations Thus the invention provides a composition composing (a) a NTH0861 protein and (b) at least one further NTHi protein The invention also provides a composition comprising (a) a NTH0863 protein, and (b) at least one further NTHi protein The invention also provides a composition comprising (a) a NTH0865 protein and (b) at least one further NTHi protein The invention also provides a composition comprising (a) a NTH0867 protein, and (b) at least one further NTHi protein The further NTHi protein can be selected from proteins of the invention as described above
The combinations are picferably selected within these four proteins, and so the invention provides a composition comprising two or more (i e 2, 3 or 4) of NTH086I, NTH0863 NTH0865 and/or NTH0S67 Preferred compositions comprise (1) NTH0861 and NTH0863 (2) NTH0861 and NTH0865, (3)NTII0861 and NTH0867, (4)NTH0863 and NTH0865, (5)NTH0863 and NTH0867 (6)NTH0865 andNTH0867, (7)NTH0861 NTH0863 andNTH0865 (8)NTH0861,NTH0863 and NTH0867, (9) NTH0863, NTH0865 and NTH0867 (10) NTH0861, NTH0865 and NTH08671 (II) NTH0861.NTH0863 NTH0865 and NTH0867
The NTH0861 protein pieferably comprises SEQ ID NO 1566, SEQ ID NO 5095, or an amino acid sequence having sequence identity (as described above) to SEQ ID NO 1566 and/or to SEQ ID NO 5095 The NTH0863 protein preferably comprises SEQ ID NO 1570 SEQ ID NO 5094, or an amino acid sequence having sequence identity (as described above) to SEQ ID NO 1570 and/or to SEQ ID NO 5094 The NTH0865 protein preferably comprises SEQ ID NO 1574 SEQ ID NO 5093, or an amino acid sequence having sequence identity (as described above) to SEQ ID NO 1574 and/or to SEQ ID NO 5093 The NTH0867 protein pieferably comprises SEQ ID NO 1578 SEQ
-17-

WO 2005/111066PCT/IB2005/001775
ID NO 5092, or an amino acid sequence having sequence identity (as described above) to SEQ ID NO 1578 and/or to SEQ ID NO 5092
Further antigemc components of compositions of the invention
The invention also provides a composition comprising a polypeptide or the invention and one or more of the following further antigens
— a sacchande antigen from N memngitidis serogroup A, C, W135 and/or Y (preferably all
four), such as the oligosaccharide disclosed in ref. 103 from serogroup C [see also ref 104] or
the oligosaccharides of ref 105
— a sacchande antigen from Streptococcus pneunomae [eg 106 107 108]
— an antigen from hepatitis A virus, such as inactivated virus [e g 109 110]
— an antigen from hepatitis B virus, such as the surface and/or core antigens {eg 110, 111]
— a diphtheria antigen such as a diphtheria toxoid [e g chapter 3 of ref 112] e g the CRM197
mutant [eg 113]
— a tetanus antigen, such as a tetanus toxoid [e g chapter 4 of ref 112]
— an antigen from Boidetella pertussis such as pertussis holotoxm (PT) and filamentous
haemagglutinin (FHA) from B pertussis, optionally also in combination with pertactm and/or
agglutinogens 2 and 3 [e g refs 114 & 115]
— a sacchande antigen from Haemophilus influenzae B [e g 104]
— polio antigen(s) [e g 116,117] such as IPV
— measles, mumps and/01 rubella antigens [e g chapters 9,10 & 11 of ref 112]
— influenza antigen(s) [eg chapter 19 of ref 112], such as the haemagglutinin and/or
neuramimdase surface proteins
— an antigen from M01 axella catarralis [eg 118]
— an protein antigen from Streptococcus agalactiae (group B streptococcus) [eg 119 120]
— a sacchande antigen from Streptococcus agalactiae (group B streptococcus)
— an antigen from Streptococcus pyogenes (group A streptococcus) [e g 120,121 122J
— an antigen from Staphylococcus aureus [e g 123]
The composition may comprise one 01 more of these further antigens
Toxic protein antigens may be detoxified where necessary (eg detoxification of pertussis toxin by chemical and/or genetic means [115])
Where a diphtheria antigen is included in the composition it is preferred also to include tetanus antigen and pertussis antigens Similarly where a tetanus antigen is included it is preferred also to include diphtheria and pertussis antigens Similarly, where a pertussis antigen is included it is preferred also to include diphthet 1a and tetanus antigens DTP combinations are thus preferred
Sacchande antigens are preferably in the form of conjugates Carrier proteins for the conjugates include diphtheria toxm tetanus toxin, the N meningitidis outer membrane protein [124], synthetic peptides [125,126], heat shock proteins [127,128] pertussis proteins [129 130] protein D from
-18-

WO 2005/111066PCT/IB2005/001775
H.influenzae [131], cytokines [132], lymphokines [132], streptococcal proteins, hormones [132] growth factors [132], toxin A or B from C difficile [133] iron-uptake proteins [134], etc A preferred carrier protein is the CRM197 diphtheria toxoid [135]
Antigens in the composition will typically be present at a concentration of at least lµg/ml each In general, the concentration of any given antigen will be sufficient to elicit an immune response against that antigen
As an alternative to using proteins antigens in the immunogemc compositions of the invention, nucleic acid (preferably DNA eg in the form of a plasmid) encoding the antigen may be used
Antigens are preferably adsorbed to an aluminium salt
Screening methods
The invention provides a process for determining whether a test compound binds to a polypeptide of the invention If a test compound binds to a polypeptide of the invention and this binding inhibits the life cycle of the H.influenzae bacterium then the test compound can be used as an antibiotic or as a lead compound for the design of antibiotics The process will typically comprise the steps of contacting a test compound with a polypeptide of the invention, and determining whether the test compound binds to said polypeptide Preferred polypeptides of the invention for use in these processes are enzymes (e g tKNA synthetases), membrane transporters and ribosomal polypeptides Suitable test compounds include polypeptides, polypeptides, carbohydrates, lipids, nucleic acids (e g DNA, RNA and modified forms thereof), as well as small organic compounds (e g MW between 200 and 2000 Da) The test compounds may be provided individually, but will typically be part of a library (e g a combinatorial library) Methods for detecting a binding interaction include NMR, filter binding assays, gel-retardation assays, displacement assays, surface plasmon resonance, reverse two-hybrid etc A compound which binds to a polypeptide of the invention can be tested for antibiotic activity by contacting the compound with GBS bacteria and then monitoring for inhibition of growth The invention also provides a compound identified using these methods
Preferably the process comprises the steps of (a) contacting a polypeptide of the invention with one oi more candidate compounds to give a mixture, (b) incubating the mixture to allow polypeptide and the candidate compound(s) to interact, and (c) assessing whether the candidate compound binds to the polypeptide or modulates its activity
Once a candidate compound has been identified in vitro as a compound that binds to a polypeptide of the invention then it may be desirable to perform further experiments to confirm the in vivo function of the compound in inhibiting bacterial growth and/or survival Thus the method comprise the further step of contacting the compound with a NTHi bacterium and assessing its effect
The polypeptide used in the screening process may be free in solution affixed to a solid support located on a cell surface or located intracellularly Preferably, the binding of a candidate compound
-19-

WO 2005/111066PCT/IB2005/001775
to the polypeptide is detected by means of a label directly or indirectly associated with the candidate compound The label may be a fluorophore, radioisotope, or other detectable label
General
The invention provides a computer readable medium {e g a floppy disk, a hard disk, a CD-ROM, a DVD etc) and/oi a computer memory and/or a computer database containing one or more of the sequences in the sequence listing
The term "comprising" encompasses ' including" as well as "consisting", e g a composition "comprising" X may consist exclusively of X or may include something additional eg X + Y
The term "about" in relation to a numerical value x means, for example, x±10%
The word 'substantially" does not exclude "completely" e g a composition which is substantially free" from Y may be completely free from Y Where necessary, the word "substantially" may be omitted from the definition of the invention
The N-terminus residues in the amino acid sequences in the sequence listing are given as the amino acid encoded by the first codon in the corresponding nucleotide sequence Where the first codon is not ATG it will be understood that it will be translated as methionine when the codon is a start codon, but will be translated as the indicated non-Met amino acid when the sequence is at the C-terminus of a fusion partner The invention specifically discloses and encompasses each of the amino acid sequences of the sequence listing having a K-terminus methionine residue (eg a formyl-methionine residue) in place of any indicated non-Met residue
Alternative start codons can be used in biology The amino acid sequences in the sequence listing are based on particular start codons, but downstream start codons may alternatively be used Thus the invention specifically discloses and encompasses each of the amino acid sequences of the sequence listing, starting at any methionine residue from the sequence that is downstream of the N-terminal residue shown in the sequence listing (e g SEQ ID NOS 5088, 5089 & 5090)
As indicated in the above text, nucleic acids and polypeptides of the invention may include sequences that
(a) are identical (i e 100% identical) to the sequences disclosed in the sequence listing,
(b) share sequence identity with the sequences disclosed in the sequence listing
(c) have 1 2 3 4, 5 6,1 8, 9 of 10 single nucleotide or amino acid alterations (deletions
insertions, substitutions), which may be at separate locations or may be contiguous as
compared to the sequences of (a) or (b), and
(d) when aligned with a particular sequence from the sequence listing using a pairwise alignment
algorithm a moving window of x monomers (amino acids or nucleotides) moving from start
(N-terminus ot 51) to end (C-terminus of 3r), such that for an alignment that extends to p
monomers (where p>x) there are p-x+1 such windows, each window has at least xy identical
-20-

WO 2005/111066PCT/IB2005/001775
aligned monomers, where x is selected from 20, 25, 30,35,40,45, 50, 60, 70, 80, 90,100,150, 200 y is selected irom 0 50,0 60,0 70 0 75 0 80, 0 85, 0 90, 0 91 0 92 0 93, 0 94, 0 95, 0 96 0 97, 0 98, 0 99, and if xy 18 is not an integer then it is rounded up to the nearest integer The preferred pairwise alignment algorithm is the Needleman-Wunsch global alignment algorithm [136], using default parameters (e g with Gap opening penalty =10 0, and with Gap extension penalty = 0 5, using the EBLOSUM62 scoring matrix) This algorithm is conveniently implemented in the needle tool in the EMBOSS package [137]
L
The nucleic acids and polypeptides of the invention may additionally have further sequences to the N-terminus/5' and/or C-terminus/3' of these sequences (a) to (d)
The practice of the present invention will employ, unless otherwise indicated, conventional methods of chemistry, biochemistry, molecular biology, immunology and pharmacology, within the skill of the art Such techniques are explained fully in the literature See, e g, references 138-145, etc
MODES FOR CARRYING OUT THE INVENTION
Genome sequencing has been carried out on a low-passage clinical NTHi isolate (strain 86-028NP [146]) A total of 2540 coding sequences were identified in the genome, and these are given in the sequence listing together with then inferred translation products Annotation of 1489 of the polypeptide sequences is given in Table III From the sequenced material, polypeptide-coding sequences of particular interest were selected for further work with particular attention to immunogemc proteins for vaccine development
Lipoproteins
Of the 2540 coding sequences the following 39 were identified as hpoproteins NTH0094, NTH0I63, NTH0I67, NTH0255, NTH0289, NTH0838, NTH0909, NTH0997, NTH1000, NTHI016, NTHI 174, NTH1298, NTHI313, NTHI413, NTHI416, NTH 1552, NTH1623, NTH1675, NTH1680, NTH1739, NTH1873, NTH1922, NTH1942, NTH1974, NTH2142 NTH2169 NTH2251, NTH2349, NTH2356, NTH2358, NTH2524, NTH2588, MTH2595, NTH2641, NTH2673, NTH2715, NTH2754, NTH2758, and NTH2769 Lipoprotems are surface-exposed and as such they represent accessible immunological targets eg for diagnostic and for immunisation purposes Moreover, it has been found in B burgdorferr [147] that OspA protein is immunogenic in a lipidated form but is non-immunogenic in a non-1 lpidated form, and the authors concluded that post-translational lipid attachment is a critical determinant of OspA immunogenicity
Outer membrane
As H.influenzae is a Gram-negative bacterium its cell wall includes an outer membrane Of the 2540 coding sequences, the following 48 were identified as being located in this outer membrane NTH0017, NTH0193 NTH0227, NTH0241, NTH0252, NTH0270, NTH0283, NTH0432, NTH0498, NTH0502, NTH0504 NTH05I2 NTH0539,NTH0638,NTH0647 KTH0648, NTH0788 NTH0839,NTH0867, NTH0914, NTH1054 NTH1075, NTH1082, NTH1200,NTH1203,NTH1214 NTH1290,NTH1390,NTH1582,NTH1652 NTH1666 NTH1744, NTH1819 NTH1845 NTH1900,NTHI953,NTH1956 NTHI958 NTH1962 NTH2039 NTH2232, NTH2234, NTH2235, NTH2269, NTH2448
-21-

WO 2005/111066PCT/IB2005/0O1775
NTH2484, NTH2493, and NTH2727 Outer membrane proteins (OMPs) are surface exposed and, as such they represent accessible immunological targets e g for diagnostic and for immunisation purposes OMPs are often invasins, adhesins, etc which, if blocked, offers a means of preventing bacterial infection
NTH1845 is an Aida-like autotransporter ( Lav') and is a preferred protein of the invention It is conserved between NTHi strains, including one known to cause meningitis, but there is no corresponding gene in the Rd sequence or in strain R2846 It lies between the tmk and holb genes A preferred form of NTH1845 starts at Met-22(;e SEQIDNO 5090)
Periplasm
As H.influenzae is a Gram-negative bacterium, it has a penplasm between its cell cytoplasmic membrane and its outer membrane Of the 2540 coding sequences, the following 105 were identified as being located in the penplasm NTH0014, NTH0049, NTH0057, NTH0059, NTH0106, NTH0U9, NTH0120 NTH0I32, NTH0174, NTHOI90 NTH0206, NTH0244, NTH0346, NTH0405, NTH0421, MTH0468 NTH0485, NTH0513 NTH0547 NTH0619, NTH0643, NTH0661, NTH0691, NTH0738, NTH0820, NTH0835, NTH0848, NTH0849, NTH0856 NTH086! NTH0863, NTH0865, NTH0910, NTH0926, NTH0961, NTH1015 NTH1018, NTH1121, NTH1164, NTHI185, NTH1190, NTH126I, NTH12G8, NTH1301, NTH1311, NTH1388, NTH1394, NTH1406, NTH1407, NTH14J4 NTH1435, NTH1468, NTH1541, NTH1570, NTH1600, NTH1601, NTH1619, NTH1622, NTH1724, KTH1745, NTH1773, NTH1781, NTH1798, NTHI8O7, NTH1829, NTH1865, NTH1871, NTH1892, NTHI897, "NTH1916, KTH1917, NTH1965, NTH1999, NTH2116, NTH2119, NTH2133, NTH2135, "NTH2149 NTH2150, NTH2187, NTH2217, NTH2227, NTH2256, NTH2258, NTH2277, NTH2291, NTH2316, NTH2342, NTH2344, NTH2369, NTH2394, NTH2432, NTH2434 NTH2451, NTH2496, NTH2508, NTH2537, NTH2541, NTH2572, NTH2575, NTH2610, NTH2705, KTH2726, NTH2738 and NTH2778 Periplasmic proteins represent useful immunological targets e g for diagnostic and for immunisation purposes
Inner membrane
As H.influemae is a Gram-negative bacterium, it has an inner membrane Of the 2540 coding sequences, the following 740 were identified as being located in the inner membrane NTH0002, NTHO0I5, NTH0Q19, NTHOQ20, NTH0021, NTH0025, NTH0032, NTH0034, NTH0035, NTH0041, NTH0043, NTH0045, NTH0048, NTH0050, "NTH0052, NTH0060, NTH0061 NTH0067, -NTH0073, NTH0076, NTH0085, NTH0089, NTH0091, NTH0097, NTHOI07, NTH0110, NTH0116, NTH0118, NTH0121, NTH0I28, NTH0134, NTH0135, WTH0151, NTHO155, NTH0157, NTH0158, NTH0180, NTH0184, WTH0185 NTH0186 NTH0189, NTH0199, NTH0203, NTH0208, NTH0209, WTH0223, NTH0224 NTH0228, NTH0232, MTH0237, NTH0238, NTH0242, NTH0247, NTH0248, KTH0251, NTH0253, NTH0254, KTH02S6, NTH0263, NTH0269, KTH0278, NTH0279, NTH0280, KTH0290, KTH0295, NTH0297, NTH0302, NTHO307, NTH0311 , NTH0317, NTH0320 NTH032I, NTH0325, NTH0326, NTH0333, NTH0334, NTH0341, NTH0347, NTH0351, NTH0352, NTH0353, NTH0356, KrH0358, NTH0366, NTH0371, NTH0372, NTH0388, NTH0397 NTH0400, NTH040I, NTH0402 NTH0407, NTH0411, NTH0412, NTH0417.NTH0418 NTH0420 NTH0426, NTH0427, KTH0434, NTH0435 NTH0437,MTH04441NTH0453,NTH0455!NTH0457,NTH0459,NTH0460J'NTH0461 NTH0462 NTH0463, NTH0465, NTH0469, MTH0473, NTH0475, NTH0478, NTH0484 NTH0489 NTH0490 NTH0493, NTH0496, NTH0507,
-22-

WO 2005/111066PCT/IB2005/001775
NTH0509 NTH05I8, NTH0524, NTH0S26, NTH0528, NTH0529, NTH0544, NTH0545, NTH0549, NTH0565, NTH0566, NTH0574, NTH05S0 NTH058I, NTH0584, NTH0585, NTH0586 NTH0587, NTH0590, NTH0617 NTH0618, NTH0622, NTH0624, NTH0626, NTH0630, NTH0636, NTH0637, NTH0642 NTH0644, NTC0646, NTH0654, NTH0656, NTH0658, NTH0673, NTH0675 NTH0676, NTH0677, NTH0678, NTH0680, NTH0694, NTH0696, NTH0702, NTH0703, NTH0706, NTH0709, NTH0710, NTH0712, NTH0715, NTII0718, NTH0728, NTH0730, NTH0740, NTH0744, NTH0745, NTH0749, NTH0750, NTH0755, NTH0762 NTH0764, NTH0765, NTH0771, NTH0774, NTH0794, NTH0795, KTH0796, NTH0797, NTH0798, NTH0802, NTH0803, NTH0804, NTH0813, NTH0814, NTH0815, NTH0821, NTH0S22, NTH0827 NTH0829, NTH0834, NTH0836, NTHO85O, NTH0851, NTH0852, NTH0858, NTH0872, NTH0874, NTH0875, NTH088O, NTH0887 KTH0888, NTH0894, NTB0904, NTH0913, NTH0927, NTH0928, NTH0941, NTH0948 NTH0949, NTH0950, NTH0952 NTHO953, NTH0955, NTH0964, NTH09S8, NTH0973, NTH0986, NTH09S7 NTH09S9, NTH0994, NTH0996, NTHJ002, KTHI003,KIH1004,NTH1005 NTH1009, NTHI010 NTHI012, NTBI020 NTFI1021, NTH1026 NTHi02S,NTHIO3I, NTH1032, NTHI037, NTH1039, NTH1042, NTH1043, NTH1048 NTH1052, NTH1058, NTH1063, NTH1064, NTH1069, NTH1073, NTH1080, NTH1083 NTHIG8i NTHI085, NTH1086 NTHI087, NTHI089, NTH1090, NTH1091, NTHI092, NTHIO98 NTHII02, NTH 1103 NTHII04 NTHI106, NTH1123, NTH112-1, NTHJ125, NTHH30 NTHI138, NTH114I, NTHI150, NTHU51, NTHI178, NTHI181, NTHIJ84, NTHI188, NTH1I89, NTH119I, NTH1192, NTH1193, NTH120I, NTII1205 NTH1216 NTH1220, NTH1221,NTHI224,NTH1225)NTH1226,NTH12291NTH1230, NTH1231 NTH1233, NTH1234, NTHI236, NTH1238, NTH1240, NTHJ241, NTH125O NTH1252, NTH3254, NTH1255, NTH1256, NTH1262, NTH1273, NTH1275, NTH1279, NTH1280, NTH128I, NTHI282, NTH1283, NTH1286, NTH1287, NTH1293, NTH1295, NTH1297, NTHI300, NTH1302, NTH13O5, NTH1306 NTHI307 NTH13O8, NTH1309, NTH13I5, NTHI319, NTHI32I, NTH1327, NTH1332, NTH1334, NTH1336 NTH1337, NTH1341, NTH1346, NTH1348, KTH1354, KTH1357, NTH1359, NTHI361, NTH1365, NIH1368, NTH 1374, NTH1376, NTH1379, NTH1380, NTH1383, NTH1391, NTHI393, NTH1398, NTHI400 NTH14H, MTH14I2, NTH1420, NTHI421, NTH1425, NTH1427, NTHI428, NTH1429, NTH1430, NTH1431, NTH1434, NTH1437, NTH1438, NTHL439, NTH1447, NTH1448, NTHI450, NTH1454, NTH1455, NTH1464, MTH1467, NTHJ470, NTH1471, NTHI472, NTHI473, NTH1474, NTH1479, NTH1491, NTHI492, NTHI493, NTH1495 NTH1500 NTHl503)NTHIS06;NTHl5!0,NTHl5l5,NTHI525JNTHl526 NTHI527 NTH1528 NTHI531, NTH1532 NTH1537, NTHI538, NTH1540, NTHI548 NTHI559 NTH1562, NTH1567, NTHI569, NTIII573, NTH1575, NTHIJSI, NTHJ584, NTH15S6, NTHL587, NTHI588 NTHI590, NTH1594, NTH1597, NTH1599, NTHI602, NTH1605, NTH1606, NTHI608, NTHI609, NTH1617, NTHJ618 NTHJ620, NTH1621, NTH1625, NTH1629, NTH163I, NTHI634, NTH1637, NTH1638, NTHI653,NTHI654,NTHI6^7,NTH1662)NTH1664 NTHI668,NTH1671 NTHI686, NTH1687, NTH16S8 NTH1689 NTH1690,NTlI1692,NTH1693 NTH169S NTH1701]NTH1707,NTH17I2 NTH1718 NTH1719 NTH1722 NTHI725, NTIU729, NTH1732, NTHI735, NTH1760, NTHI767, NTH1770, NTHI778, NTHI779, NTH17S2 NTH1783, NTH1788 NTH1793, NTHI795, NTH1796, NTH1799, NTHI803, NTHI80, NTH1806 NTHI8I3, NTH1815, NTHI820 NTH1824, MTH1828, NTH1835, NTHI836, NTH1842, NTH1849, NTHI850 NTHI859 NTHI861, NTHI870, NTH1872, NTH1881 NTH1882 NTH1885, NTH1888, NTH1889, NTH1891, NTH1896, NTH1898 NTH1899, NTHI906, NTH1908, NTHI919, NTHI923, NTH1925, NTH1927, NTH1935, HTH1919, NTH1941, NTH1951, NTH1960, NTOI963, NTH1966, -NTH1967, NTH1968, NTHI978 NTH1981 NTH1986, NTH1992, NTH1993 NTH1995 NTH1996 NTH1997 NTH1998, NTH200I, NTH2005 NTH2008,NTH2009,NTH2010,NTH2024 NTH2025 NTH2038 NTH2040, NTH204I, NTH2043, NTH2050, NTH2052 NTH2055,NTH2060;NTH2062 NTH2064 NTH2065, NTH2070, NTH207I.NTH2073, NTH2078, NTH2079,
-23-

WO 2005/111066PCT/IB2005/001775
NTH2081, NTH2083, NTH2089, NTH2091, NTH2092, NTH2093, NTH2094, NTH2095, NTH2096, NTH2097 NTH2099, NTH2101, NTH2112, NTH2115, NTH2118, NTH2120, NTH2122, NTH2126, NTH212S NTH2I29 NTH2130, NTH2131, NTH2136,NTH2138 NTH2145 NTH2146 NTH2162 NTH2163 NTH2166, NTH2169, NTH2170 NTH2173 NTH2181 NTH7183, NTH2191, NTH2193 NTH2195, NTH2196, NTH2200, NTH2204, NTH2205, NTH2209, NTTO13, OTH2226, NTH2228, NTH2231, NTH2242, NTH2243 NTII2247, NTH2250 NTH2253, NTH2257, NTH2259, NTH2262, NTH2263, NTH2266, NTH2273, NTH2274, NTH2282, NTH2284, NTH2285, NTH2288, NTH2292, NTH2296, NTH2299, NTH2318, NTH2323, NTH2324, NTH2326, NTH2327, NTH2333, NTH2343, NTH2346, NTH2347, NTHJ352, NTH2361, NTH2364, NTH2365, NTH236S, NTH2370, NTH237I, NTH2376, NTH2377, NTH2381, NTH2382, NTH2388, NTH2398, NTH2402, NTH2405, NTH2406, NTH2407, NTH2408, NTH2414, NTH2422, NTH2430, NTH2433, NTH2438, NTH2447, NTH2455) NTH2457, NTH2458, NTH2472, NTH2478, NTH2481, NTH2486, NTH2495 NTH2497, NTH2498 NTH2499, NTH2501 NTH2505 NTH2525, NTH2531, NTH2532, N1H2533, NTH2534, NTH2542, NTH2543, NTH2545, NTH2546, NTH2548 NTH2549 NTH2550 NtH2552, NTH2554, NTH2556 NTH2557 NTH2558, NTH2562, NTH2566, NTH2567, NTH2568, NTH2569, NTH2570, NTH2573 NTH2S77, NTH2578 NTH2587,NTH259I,NTH2593 NTH2597, NTH2600, NTH2602, NTIJ2603, NTH2604 NTH2605, NTH2612, NTH2613, NTH26I5, NTH2616, NTH2618, NTH2626, NTH2633, NTH2640) NTH2647, NTH2648, NTH2649, NTH2650, NTH266I, NTH2663, NTH2664, NTH2667, NTH2668, NTH2674, NTH2675, N1H2680, NTH2690 NTH270I, NTH2702, NTH2703, NTH2708, NTH27U, NTH2724, NTH2725, NTH2732, NTH2735, NTH2740, NTH2743 NTH2749, NTH2750, NTH2755, NTH2756 NTH2757, NTH2764, NTH2765 NTH2774, NTH2777, NTH2779, NTH278I, NTH2793, NTH2794, NTH2796, NTH2797, NTH2798, NTH2806, NTH2807, NTH2813, NTH2814, NTH2823 and NTH2824 Inner membrane proteins represent useful immunological targets eg for diagnostic and for immunisation purposes
Of these proteins, NTH1069 in particular has been identified as a virulence-associated protein A preferred form of this protein starts at Met-27 0 s SEQ ID NO 5088) Another preferred form starts atMet-19(SEQIDNO 5089)
Adhesin
An adhesin having amino acid sequence SEQ ID NO 5091 has been identified in a NTHi strain
isolated from a patient with meningitis It is hom*ologous to the Hia adhesin from Nmeningitidis
H. influenzae Rd
The genome sequence of the serotype d strain KW20 [1,3] was published in 1995 As serotype d strains are generally not pathogens, but the sequenced NTHi strain is from a clinical infection, expressed NTHi sequences that are not seen in serotype d are likely to be the proteins that are involved in pathogenic mechanisms Blocking these proteins, either by antibiotic treatment or by antibody binding, thus has therapeutic potential Of the 2540 coding sequences the following 613 are not seen in the Rd genome NTH0001, NTH0002 NTH0004 NTH0005 NTH00I2 NTH0OI6, NTH0021, NTH0022, NTH0024, NTH0032, NTHOO33 NTH0034, NTH0035 NTH0036, NTH0037 NTH0038 NTH0040 NTH0045 NTH0050, NTH005l,NTH0052,NTH0053,NTH0064,NTH0089 NTH0092, NTH0097 NTH0101 NTH0104 NTH0110, NTH0114, NTH0122, NTH0123 NTH0124 NTH0125, NTH0129 NTH0135,NTH0136, NTH0138, NTH0I40, NTH0146 NTH0I48, NTH0151, NTH0I53 NTH0I54, NTH0I59, NTH0161, NTH0164, WTH0I69, NTH0173, NTH0176, NTH0177, -NTH0187,
-24-

WO 2005/111066
PCT/IB2005/001775
NTH0191, NTH0192, NTH0193, NTH0194, NTH0195, NTHQ197, NTH0198, NTH0199 NTH0226, NTH0235, NTH0236, NTH0238,NTH0250,NTH0251,NTH0254,NTH0255,NTH0256 NTH0264, NTH0265, NTII0278 NTH0279 NTH0280, NTH02S2, NTH0283, NTH0284, NTH0285, NTH0289, NTH0297 NTH0298, NTH0299 NTH0300, NTH0302, NTH0307 NTH0308JNTH0310,NTH03I2JNTH03i3 NTH0319 NTH0327, NTH0328, NTH033! NTH0334, NTHO335' MH0339, NTH0341,NTH0348,NTH0363 NTH0371 NTH0375, NTH0378 NTH0379, NTH0384, NTH0385, NTH0396, NTH0407, NTH0408, NTH041I, NTH0417, NTH0419, NTH0420, NTH0424, NTH0429, NTH0430, NTH0431, NTH0432 NTH0433, NTH0434, NTH0435, NTH0438, NTH0455 NTH0478, N1H0484, NTH0485, NTH0486, NTH0487, NTH0488, NTH0489 NTH0498, NTH0500, NTH0501, NTH0506, NTH0509, WTH0510, NTH05I1, NTH0520, KTH0523, NTH0526, NTH0527, NTH0531, WTH0534, NTH0536, NTH0539 NTH0539, NTH0561, NTH0573, NTH0577 NTH0579, NTH0580, NTH0581 NTH0582, NTH0583, NTH0584, NTH0585, NTH0586, NTH0588 NTH0599, NTH0603, NTH0604, NTH0606, NTH0615 NTH0617, NTH063I NTH0637, NTH0644, NTH0645, NTH06:i3, NTH0662, NTH0663, NTH0664, NTH0667, NTH0668, NTH0673, NTH0677, NTH0680, NTH0681 NTH0683, NTH0687 NTH0690 NTH0691 NTH0692, NTH0694, NTH0695, NTH0696 NTH0706,NTH0707,NTH0711,NTH0715 NTH0716, NTH0717, NTH0721 NTH0724, NTH0725, NTH0726, NTH0728, NTH0729, NTH0730, NTH0749 NTH0752, NTH0756, NTH0768, NTH0776, NTH0792, NTH0797, NTH0818, NTH0827, NTH0832 NTH0839, NTH0841, NTH0843, NTH0844, NTH0862, NTH0864, NTH0866, NTH0867, NTH0877, NTH0879, NTH0885 NTH0886 NTH0892, NTH0895, NTH0896, NTH0900, NTH0901, NTH0904, NTH0906 NTH0921 NTH0924, NTH0928, WTH0929, NTH0930, NTH0931, NTH0932, NTH0933 NTH0937, NTH0938, NTH0942, NTH0949, NTH0953, NTH0955, NTH0961, NTH0964, NTH0970, NTH0971 NTH0972 KTH0973, NTH0985, NTH0987, NTH0991, NTH0992, NTH0993, NTH0994, NTH0995, NTH0996, NTH1007 NTH1016 NTH1017, NTH1020, NTHI025, NTHI026, NTH1027, NTH1028, NTH1029, NTHJ037, WTH1040, "NTH1049, KTH1067, NTH1069, NTH1070, NTH1073, NTHI082, NTH1086,NTH1089 NTHI090, NTHII08, NTH11I1, NTHI112, NTH1114, NTH(115, NTH1I16, "NTH1122, NTHI129, NTH1131, NTH1142, NTH! 149, NTH1150, NTH1I53, NTH1I57, NTHI159, NTH1161, NTH1162, NTHI176, NTHU78, NTHlI79,Nn-il!93 NTH1195 NTHU96,NTHI204,NTH1205,NTHl207,NTHI208>NTH1209,NTH12I0 NTH12I1 NTH1214, NTH1216, NTHI220, NTHI225, NTHI234, NTH1235, NTH1237 NTH1241, NTH1244, NTH1245, NTH1246, NTH1247(NlH1248,NTH1249)NTH1250,NTH1251JNTH1252,NTH1253,NTH1270 MTH127I NTH1294 NTHI299, NTHI313,-NTH13I5t NTH1316, NTH1325 NTHI330, NTHI333, NTH1337, NTH1339, NTH1342, NTHI353, NTH1361, NTH1367, NTH1374, NTH1375, NTH1381, NTHI3S2, NTH1390 NTH139I, NTH1395 NTH1396, NTH1399, NTH1414, NTH14I5, NTHI418 NTH1419, NTH1437, KTH1441, NTH1454, NTH1456, NIH1471, KTH1474, NTH1487, MTH1489, NTH1490, NTH149I, NTH1492, NTH1493, KTHH94 NTH1495, NTH1496, NTH1497, KTH1504, NTH15I6, NTH1540, NTH1543 NTH1555,NTHl563 NTH1564 KTH1567)NTHi5713NTH1573,NTH1574, KTH1580,-NTHi587 NTH1598, NTH1599, NTH1600, NTHI601 NTH1602.NTH1603, NTH1605 NTHI606, NTH1607, "NTH161 1, NTH16I2,NTH16I5, NTH1616 NTH1626, NTH1627, NTH1628, NTHI647, NTH1656 NTH1657, NTHI658, KTHI676, NTH1677, NTH1687, NTH1697,NTH17O2, NTH1703, NTHI713, MTH1734, NTH1740, NTH1742, NTH1744 NTH1745, NTHI748, NTH1749 N1HI751, NTH1752, NTH1753, NTH1754, NTH1755, NTHI756, NTHI757, NTHI758, MTH1759, NTHI760, NTH1765, NTH1769,NTH1770 NTH1778, NTH1798, NTH1804, NTH1811, NTH18I2. NTHI815, NTHI816 NTH1817, NTH1818, NTH1820, NTHI82lf NTH1822, NTH1829, NTH1832 NTH1833, NTH1837, NTH1842 NTH1845, NTH1854, NTH1857, NTH1904, NTH1910 NTH1914, NTHI916, NTH1920, NTH1921, NTH1922, NTH1943, NTH1946 NTHI947, NTH1948, NTH1956 NTHI962, NTH1964, NTH1968, NTH1989, NTH1994, NTH2019, NTH203!, NTH2035, NTH2043, NTH2056
-25

WO 2005/111066PCT/IB2005/001775
NTH2060 NTH2069, NTH2075, NTH2093, NTH2096, NTH2109, NTH2110, NTH21I2, NTH2113, NTH2114, NTH2117, NTH2156, NTH2159, NTH2170, NTH2197, NTH2198, NTH2199, NTH2206, NTH2207, NTH2216 NTH2217, NTH2219, NTH2220, NTH2221, NTH2222, NTH2223, NTH2226, NTH2229, NTH2245, NTH2273, NTH22S4 NTH2287, NTH2305, NTH2309, NTH2315, NTH2316, NTH2323, NTH2326 NTH2330, NTH2332) NTH2343, NTH2349, NTH2353, NTH2362, NTH2363, NTH2364, NTH2386, NTH2414, NTH2442 NTH2451, NTH2455 NTH2456, NTH2457, NTH2458, KTH2460 NTH2461, NTH2463, NTH2464, NTH2466, NTH2467, NTH2468 NTH2471, NTH2480, NTH248I, NTH2482, NTH2483, NTH2484, NTH2485, NTH2486, NTH2487, NTH2488, NTH2500, NTH2510, NTH2524, NTH2525, NTH2527, NTH2528, NTH2536 NTH2537 NTH2549, NTH2562, NTH2563, NTH2572, NTH2573, NTH2575, NTH2584, NTH2585, NTH2590, NTH2604, NTH2607, NTH2608, NTH2609, NTH2635, NTH2647, NTH2648, NTH2650, NTH2655, NTH2664, NTH2668 NTH2679, NTH2684, NTH2693, NTH2694, NTH2696, NTH2697, NTH2703, NTH2704, NTH2706, NTH2707 NTH2708, NTH2709, NTH2710, NTH2711, NTH2712, NTH2713, NTH2715, NTH2716, NTH2718, NTH2719, NTH2720, NTH2721, NTH2723, NTH2724, NTH2725, NTH2726, NTH2727, NTH2729, NTH2730, NTH2731, NTH2737, NTH2744, NTH2753, NTH2778, NTH2781, NTH2783, NTH2784, NTH2785, NTH2791, NTH2804, NTH2806 NTH2809, NTH2810, and NTH2S16
NTH0861 to NTH0867
Protein NMB0419 from Neisseria meningitidis has been found to participate in the meningococcal invasion mechanism [2] The protein was shown to modulate bactcnal interaction with monolayers of human repiratory epithelial cells, promoting invasion A hom*ologous protein BPF001 is seen in H.influenzae biogroup aegyptius, but study of tins protein was not possible
The NTHi genome includes a region (SEQ ID NO 5081) encoding a string of four polypeptides (NTH0861, NTH0863, NTII0865 and NTH0867) with strong similarity to NMB0419 This legion and the four polypeptides are shown below

-26-

WO 2005/111066PCT/IB2005/001775
TAGAGGGGAGCTCTAATGCCA&CTTTACAATGCGAATTTTGGAATGTAGGGCAAGGGTTA R G E L *
TTTTCAAGTGGGCGTATTCAAATGGGACGCCCCCATTCXTTSGGTTTATGGTTtG CAflGTTCCTCATCATGGTTCAAAGCCAATTTTAGTGAATAAAMTARAAGRTTATCC?T'r
CfiTTCAaTTTARTaGGaAAACaflATGRMCTCACAAAftaCACTTCTTACCACCGCACrTT
(SEQ ID NO 1574) HTSO865M K L T K T L h T T A I. F
TCGGtGCTTCTATTTTTTCTTTTCAATCCiVCCGCTTGGGCGGATACGCCGGAACAGCAAT GASIFSFOSTAWA D T P E Q Q F
TCCAACMGGTTl'AACCGCTTAirGliGCAaAGCAACTaTCAAaCCGCCTT'rJ51SACTXTGGT QQGLTAYEQSNYQTArKLWL
TACCTCTGGCGGAGCAGGGAGATGCACAGGCTCAAGGTGGTTTGGGCATGATGI'ATGAaA PLAEQGDAQAQGGLGMMYER
GAGGACTTCGCGTARAACAAGATGArrTCAAPGCAGTGAACTGGTATCGCAAAGCGGCGG GLGVKQDDFK-a^Wffyfi iC . A A JS
RGCAGGGGGATGCAGATGCTCAATTAaATTTGGGTGCGATGTATGCAATCGGACGTGGCG
QG DADAQLNLGAMY&IGRGV
TAAAACAAGATGG'TGTg^aagaSGTC^GTGGTTTCGCAAfiGCGGCAGAGCAGSGAAATG JCflDffVEAVKW?fl K A A E Q G S A
CAAAGGCTCAAAATGGTTrGGGCAJ-GATGTATGACGGAGGACrTGGCATAAAACAAGATT KAQUGX.GMMYDGGLGIKODX
ATTTCAAAGCGGTGAAATGGCATCGCAAftGCGGCGGAGCAGGGWATGGAGGTGCTCAAG FKAVKVJHRKAREQGYGGAQV
TTATQTTGGGATTCTCATATCTI'a'CGGGAAAAGGTGTTCAAGTAAATAAAICTTTAGCCA MLGFSYLSGKGVQVNKSIJAK
AAGAATGGXTTGGTAAGGCTTGTGATAATGGTGAACAAGTGGGrTGTGAATA'FTA'rGGrP
B W P 6 K ADHGEO^GEtYGK
AGCTAAATAGAGGGGAACGCTAATGCCAACTTTACAATGCGAATTTTGGAATGTAGGGCA LARGER*
AGGGTTATTTTCAAGTGGGCGTATTCAAATGGGAGACGCCCAAGCCTTTCATTGGGTTTA TGGTtTGCAAGTTCCTCATCATGGTITCAAAGCCAATTTAGTGAATAAAAAfSAAAGAT'I'
ATCCATTCAI'TCAATTTAATMGAAAACAAAATGAAACTCACAAAAACPCTTCTIIACCAC
CSBQ ID KO 1570} MTO0863MKI.TKTLI.TT
CGCACTTTTCGGTGCTTCTGTAMTTCTTTTCAATCCACCGCTTGGGCGGATACGCTGGA A_^^ F_G_ A5VF5FQSTAWA D X L B
ACAGCAAT7CCAACAAGGTTTAACCGCTTATGACCAAAGCAACTATCAAACCGCCTTTAA QQFQQGLTAYEQSNYQTAFK
ACTTrGGTTACCTATGGCAGAGCAGGGATATGCPAAGGCTCAAT'ETAATTI'GGGCGTGAT LWLPMAEQGYAKAQFNLGVM
GTATGCTAAGGGGCAAGGCGTCAAACAAGATGATrTTGAAGCGGTGAAGTGGTTTCGCAA ySKGQGVKQDDFEAVKWFSK
-27-

-28-
WO 2005/111066PCT/IB2005/001775

-29-
WO 2005/111066PCT/IB2005/001775

WO 2005/111066PCT/IB2005/001775

The serial repeats of four closely-related genes that axe also related to genes involved in bacterial invasion is noteworthy, and NTH0861, NTH0863 NTH0865 and NTH0867 are of particular interest for immunisation purposes NTH0867 in particular is an outer-membrane protein that is not seen in the Rd genome, and is of special interest
Moreover as well as being caused by NTHi, acute otitis media is often caused by Moraxella catarrihalis and Streptococcus pneumoniae Four proteins have been identified that in the NTHi
-30-

WO 2005/111066PCT/IB2005/001775
genome that have hom*ologs in the Mcatarrhalis genome, namely NTH0861 (SEQ ID NO 1566), NTH0863(SEQIDNO 1570),NTH0865 (SEQIDNO 1574) and NTH0867 (SEQIDNO 1578) These proteins can thus be used as antigens for a general AOM vaccine The corresponding Mcatarrhalis antigens can also be used, either on their own or in combination with the NTHi antigens

-31-
A variant of SEQ ID NO 1566 is given as SEQ ID NO 5095

WO 2005/111066PCT/IB2005/001775
Preferred NTH0861 proteins have identity to both of SEQ ID NOS 1566 and 5095 Preferred NTH0863 proteins have identity to both of SEQ ID NOS 1570 and 5094 Preferred NTH0865 proteins have identity to both of SEQ ID NOS 1574 and 5093 Preferred NTH0867 proteins have identity to both of SEQ ID NOS 1578 and 5092
It will be understood that the invention has been described by way of example only and modifications may be made whilst remaining within the scope and spirit of the invention
-32

WO 2005/111066PC1/IB2005/001775
TABLE I - MISSING NTHnnnn VALUES between NTH0001 and NTH2832

0008
0031
0042
0054
0056
0066
0074
0077
0093
0111
0160
0162
0166
0171
0179
0210
0213
0214
0219
0229
0231
0276
0281
0288
0293
0322
0332
0357
0362
0381
0395
0398
0404
0406
0409
0410
0415
0439
0445
0446
0452
0466
0471
0491
0497
0516
0533
0538
0541
0546
0551
0553
0556
0569
0578
0598
0600
0610
0623
0639
0649
0666
0693
0713
0722
0727
0742
0746
0757
0763
0780
0789
0791
0793
0800
0809
0816
0855
0883
0891
0902
0911
0915
0916
0922
0943
0944
0957
0975
0978
0980
0998
0999
1013
1034
1044
1047
1055
1056
1065
1072
1076
1079
1099
1113
1118
1119
1128
1133
1134
1136
1146
1147
1158
1160
1170
1194
1199
1213
1219
1223
1232
1243
1257
1260
1288
1289
1296
1312
1317
1329
1335
1347
1350
1356
1358
1362
1364
1372
1377
1385
1452
1458
1469
1478
1481
1486
1488
1502
1517
1518
1529
1536
1547
1553
1557
1560
1566
1592
1595
1596
1604
1642
1649
1667
1669
1674
1691
1699
1711
1715
1721
1723
1727
1728
1731
1737
1741
1743
1746
1750
1761
1772
1784
1797
1810
1814
1823
1843
1844
1856
1864
1866
1878
1902
1909
1918
1957
1961
1979
1985
1987
1990
2004
2006
2015
2017
2023
2033
2037
2042
2054
2077
2080
2098
2104
2107
2125
2154
2167
2171
2174
2179
2194
2203
2210
2218
2237
2239
2240
2244
2254
2255
2267
2268
2270
2275
2278
2286
2290
2295
2300
2302
2312
2320
2334
2340
2355
2357
2366
2367
2374
2380
2400
2409
2431
2444
2459
2523
2540
2547
2551
2574
2580
2589
2601
2611
2614
2624
2628
2637
2639
2645
2652
2658
2662
2677
2692
2699
2700
2728
2734
2746
2760
2767
2773
2787
2799
2805
2808
2819
2822

NTH0001
NTH0002
NTH0004
NTH0005
NTH0012
NTH0014
NTII0015
NTH0016
NTH0017
NTH00I9
NTH0020
NTH0021
NTH0022
NTH0024
NTH0025
NTH0032
NTH0033
NTH0034
NTH0035
NTH0036
NTH0037
NTH0038
NTH0040
"NTH0041
NTH0043
NTH0045
NTH0048
NTH0049
NTH005O
NTH0051
"NTH0052
NTH0053
"NTH0057
NTH0059
NTH006O
NTH0061
NTH0064
NTH0067
NTH0073
NTH0076
MTH0085
NTH0089
NTH0091
NTH0092
NTH0094
"NTH0097
NTHO101
NTH0104
NTH0106
NTH0107
NTH0110
NTH0I14
NTH0116
NTHOllS
NTH0119
NTH0120
NTH0121
NTH0122
NTH0123
NTH0124
NTH0125
NTH0128
NTH0129
NTH0132
NTH0134
NTH0135
NTH0136
NTH0138
NTH0140
NTH0146
NTH0148
"NTH0151
NTH0153
NTH0154
NTH0I55
NTH0157
NTH0158
NTH0159
NTH0161
NTH0163
NTH0164
NTH0167
NTH0169
NTH0173
NTH0174
NTH0176
NTH0I77
NTH0180
NTH0184
NTH0185
NTH0186
NTH0187
NTH0L89
NTH0190
NTH0191
NTH0192
-33-

WO 2005/111066PCT/IB2005/001775
NTH0193NTH0I94NTH0195 NTH0197 NTH0198NTH0199NTH0203NTH0206
NTH0208NTH0209NTH0223 NTH0224 NTH0226NTII0227NTH0228NTH0232
NTH0235NIH0236NTH0237 NTH0238 NTH0241NTH0242NTH0244NTH0247
NTH0248NTH0250NTH025I NTH0252 NTH0253NTH0254NTH0255NIH0256
NTH0263NTH0264NTH0265 NTH0269 NTH0270NTH0278NTH0279NTH0280
NTH0282NTH0283NTH0284 NTH0285 NTH0289NTH0290NTPI0295NTH0297
NTH0298NTH0299NTH0300 NTH0302 NTH0307NTH0308NTH03I0NTH0311
NTII0312NTH0313NTH0317 NTHO319 NTH0320NTH0321NTH0325NTH0326
NTH0327NTH0328NTH0331 NTH0333 NTH0334NTH0335NTH0339NTH0341
NTH0346NTH0347NTH0348 NTH0351 NTH0352NTH0353NTH0356NTH0358
NTH0363NTH0366NTH0371 NTH0372 KTH0375NTH0378NTO0379NTH0384
NTH0385NTH0388NTH0396 NTH0397 NTH0400NTH0401NTH0402NTH0405
NTH0407NTH0408NTN0411 NTH0412 NTH0417NTII0418NTH0419NTH0420
NTH0421NTH0424NTH0426 NTH0427 NTH0429NTH0430NTH0431NTH0432
NTH0433NTII0434NTH0435 NTH0437 NTH0438NTH0444NTH0453NTH0455
NTII0457NTH0459NTH0460 NTH0461 NTH0462NTH0463NTH0465NTH0468
NTH0469NTH0473NTH0475 NTH0478 NTH0484NTH0485NTH0486NTH0487
NTH0488NTH0489NTH0490 NTH0493 NTH0496NTH0498NTH0500NTH0501
NTH0502NTH0504NTH0506 NTH0507 NTH0509NTH0510NTH0511NTH0512
NTH0513NTH0518NTH0520 NTH0523 NTH0524NTH0526NTH0527NTHO528
NTH0529NTH0531NTH0534 NTH0536 NTH0539NTH0544NTH0545N1H0547
NTH0549NTH0559NTII0561 NTH0565 NTH0566NTH0573NTH0574NTH0577
NTII0579NTH0580NTH0581 NTH0582 NTH0583NTH0584NTH0585NTH0586
NTH0587NTH0588NTH0590 NTH0599 NTH0603NTH0604NTII0606KTH0615
N1H0617NTH0618NTH0619 NTH0622 NTH0624NTO0626"NTH0630NTH0631
NTH0636NTH0637NTH0638 NTH0642 NTH0643NTH0644NTH0645NTH0646
NTH0647NTH0648NTH0653 NTH06S4 NTH0656NTH0658NTH0661NTH0662
NTH0663NTH0664NTH0667 NTH0668 NTH0673NTH0675NTH0676NTH0677
NTH0678NTH0680NTH0681 NTH0683 NTH0687NTH0690NTH0691NTH0692
NTH0694NTH0695NTH0696 NTH0702 NTH0703NTH0706NTH0707NTH0709
NTII0710NTH0711NTH0712 NTH0715 NTH0716NTH0717NTH0718NTH0721
NTH0724NTH0725NTH0726 NTH0728 NTH0729NTO0730NTH0738NTH0740
NTH0744NTH0745NTH0749 NTH0750 NTH0752NTH0755NTH0756NTH0762
NTH0764NTH0765NTH0768 NTH0771 NTH0774NTH0776NTH0788NTH0792
TSTTH0794NTH0795NTH0796 NTH0797 NTH0798NTH0802"NTH0803NTH0804
NTH0813NTH0814NTH0815 NTH0818 NTH0820NTH0821NTH0822NTH0827
NTH0829NTH0832NTH0834 NTH0835 NTH0836NTH0838NTII0839NTH0841
NTH0843NTH0844NTH0848 NTH0849 NTII0850NTH0851NTH0852NTH0856
-34-

WO 2005/111066PCT/IB2005/001775
NTH0858NTH0861 NTH0862 NTH0863NTH0864 NTH0865 NTH0866 NTH0867
NTH0872NTH0874 NTH0875NTH0877NTH0879 NTHOS80 NTH0885 NTH0886
NTH0887NTH0888NTH0892NTH0894NTH0895 NTH0896 NTH0900 NTH0901
NTH0904NTH0906NTH0909NTH0910NTH0913 NTH0914 NTH0921 NTH0924
NTH0926NTH0927NTH0928NTH0929NTH0930 NTH0931 NTH0932 NTH0933
NTH0937NTH0938NTH0941NTH0942NTH0948 NTH0949 NTH0950 NTH0952
NTH0953NTH0955NTH0961NTH0964NTH0968 NTH0970 NTH0971 NTH0972
NTH0973NTH0985NTH0986NTH0987NTH0989 NTH0991 NTH0992 NTH0993
NTH0994NTH0995NTH0996NTH0997NTH1000 NTH1002 NTH1003 NTH1004
NTH1005NTH1007NTH1009NTH1010NTH1012 NTH1015 NTH1016 NTH1017
NTH1018NTH1020NTH1021NTH1025NTH1026 NTH1027 NTH1028 NTH1029
NTH1031NTH1032NTH1037NTH1O39NTH1040 NTHI042 NTH1043 NTH1048
NTH1049NTH1052NTH1054NTH1058NTH1063 NTH1064 NTH1067 NTH1069
NTH1070NTH1073NTH1075NTH1080NTH1082 NTH1083 NTH1084 NTH1085
NTH1086NTH1087NTH1089NTH1090NTH1091 NTHI092 NTH1098 NTHH02
NTH1103NTH1104NTH1106NTH1108NTH1111 NTH1112 NTH1114 NTH1115
NTH1116NTHH21NTH1122NTH1123NTH1124 NTH1125 NTH1129 NTH1130
NTHl31NTH1138NTH1141NTH1142NTH1149 NTH1150 NTHU51 NTH1153
NTH1157NTH1159NTH1161NTH1162NTH1164 NTH1174 NTH1176 NTH1178
NTH1179NTH1181NTH1184NTH1185NTH1188 NTH1189 NTHil90 NTH1191
NTH1I92NTHU93NTH1195NTH1196NTH1200 NTH120I NTH1203 NTH1204
NTH1205NTH1207NTH1208NTH1209NTH1210 NTH1211 NTH1214 NTH1216
NTH1220NTH1221NTH1224NTH1225NTH1226 NTH1229 NTH1230 NTH1231
NTH1233NTH1234NTH1235NTHI236NTH1237 NTH1238 NTH1240 NTH1241
"NTH1244N1H1245NTH1246NTH1247NTH1248 NTH1249 NTH1250 NTH1251
NTH1252NTH1253NTH1254NTH1255NTH1256 NTH1261 NTH1262 NTH1268
NTH1270NTH1271NTH1273NTH1275NTH1279 NTH1280 NTH1281 NTH1282
NTH1283NTH1286NTH1287NTH1290NTH1293 NTH1294 NTH1295 NTH1297
NTH1298NTH1299NTH1300NTH1301NTH1302 NTH1305 NTH1306 NTH1307
NTH1308NTH1309NTH13UKTH1313NTH1315 NTH1316 NTH1319 NTH1321
NTH1325NTH1327NTH1330NTH1332NTH1333 NTH1334 NTH1336 NTH1337
NTH1339NTH1341NTH1342NTH1346NTH1348 NTH1353 NTH1354 NTH1357
NTH1359NTH1361KIH1363NTH1365NTH1367 NTH1368 NTH1374 NTH1375
N1H1376NTH1379-NTH1380NTH1381NTH1382 NTH1383 NTH1388 NTH1390
NTH1391NTH1393NTH1394NTH1395NTHI396 NTH1398 NTH1399 NTH1400
NTH1406NTHI407NTH1411NTH1412NTHI413 NTH1414 NTHH15 NTH1416
NTH1418NTH1419NTH1420NTH1421NTH1425 NTH1427 NTHI428 NTH1429
NTH1430NTH143INTH1434NTH1435NTHI437 NTH1438 NTH1439 NTH1441
-35-

WO 2005/111066PCT/IB2005/001775
NTH1447NTH1448 NTH1450NTHI454 NTH1455 NTH1456 NTH1464 NTH1467
NTH2468NTH1470 NTH1471NTH1472 NTH1473 NTH1474 NTH1479 NTH1487
NTH1489NTH1490 NTH1491NTH1492 NTH1493 NTH1494 NTH1495 NTH1496
NTH1497NTH1500 NTH1503NTH1504 NTH1506 NTH1510 NTH1515 NTH1516
NTH1525NTH1526 NTH1527NTH1528 NTH1531 NTH1532 NIH1537 NTH1538
NTH1540NTII1541 NTH1543NTH1548 NTH1552 NTH1555 NTH1559 NTH1562
NTH1563NTH1564 NTH1567NTH1569 NTH1570 NTH1571 NIH1573 NIH1574
NTH1575NTH1580 NTH1581NTH1582 NTH1584 NTHI586 NTH1587 NTH1588
NTH1590NTH1594 NTH1597NTH1598 NTH1599 NTH1600 NTH1601 NTH1602
NTH1603NTH1605 NTH1606NTH1607 NTH1608 NTH16O9 NTH1611 NTH1612
NTH1615NTH1616 NTH1617NTH1618 NTH1619 NTH1620 NTH1621 NTH1622
NTH1623NTH1625 NTH1626NTFil627 NTH1628 NTH1629 NTH1631 NTH1634
NTH1637NTH1638 NTH1647NTH1652 NTH1653 NTH1654 NTH1656 NTH1657
NTH1658NTH1662 NTH1664NTH1666 NTH1668 NTH1671 NTHI675 NTH1676
NTH1677NTH1680 NTH1686NTH1687 NTH1688 NTH1689 NTH1690 NTH1692
NTH1693NTH1697 N7H1698NTH1701 NTH1702 NTH1703 NTH1707 NTH1712
NTH1713NTH1718 NTH1719NTH1722 NTFI1724 NTH1725 NTHI729 NTH1732
NTH1734NTH1735 NTH1739NTH1740 NTH1742 NTHI1744 NTH1745 NTH1748
NTH1749NTH1751 NTH1752NTH1753 NTH1754 NTH1755 NTH1756 NTH1757
N1H1758NTH1759 NTH1760NTH1765 NTH1767 NTH1769 NTH1770 NTH1773
NTH1778NTH1779 NTH1781NTH1782 NTH1783 NTH1788 NTH1793 NTH1795
NTH1796NTH1798 NTH1799NTH1803 NTH1804 NTH1805 NTH1806 N1H1807
NTH1811NTH1812 NTH1813NTH1815 NTH1816 NTH1817 NTH1818 NTH1819
NTH1820NTH1821 NTH1822NTH1824 NTH1828 NTHI829 NTH1832 NTH1833
NTH1835NTH1836 NTH1837NTHI842 NTH1845 NTH1849 NTH1850 NTH1854
NTH1857NTH1859 NTH1861NTH1865 NTH1870 NTHIS71 NTH1872 NTH1873
NTH1881NTH1882 NTH1885NTH1888 NTH1889 NTH1891 NTH1892 NTH1896
NTH1897NTH1898 NTH1899NTH1900 NTH1904 NTH1906 NTH1908 NTH1910
NTH1914NTH1916 NTH1917NTH1919 NTH1920 NTH1921 NTH1922 NTH1923
NTH1925NTII1927 NTH1935NTH1939 NTH1941 NTH1942 K1H1945 NTH1946
NTH1947NTH1948 NTH1951NTH1953 NTH1956 NTH1958 NTHI960 NTH1962
NTH1963NTH1964 NTH1965NTH1966 N1H1967 NTH1968 NTH1974 NTH1978
NTH1981NTH1986 NTH1989NTH1992 NTH1993 NTH1994 NTH1995 NTH1996
NTH1997NTH1998 NTH1999NTH2001 NTH2005 NTH2008 NTH2009 NTH2010
NTH2019NTH2024 NTH2025NTH2031 NTH2035 NTH2038 NTH2039 NTH2040
NTH2041NTH2043 NTH2050NTH2052 NTH2055 NTH2056 NTH2060 NTH2062
NTH2064NTH2065 NTH2069NTH2070 NTH2071 NTH2073 NTH2075 NTH2078
NTH2079NTH2081 NTH2083NTH2089 NTH2091 NTH2092 "NTH2093 NTH2094
-36-

WO 2005/111066PCT/IB2005/001775
NTH2095 NTH2096 NTH2097 NTH2099 NTH2101NTH2109NTH2110NTH2112
NTH2113 NTH2114 NTH2115 NTH2116 NTH2117NTH2118NTH2I19NTH2120
NTH2122 NTH2126 NTH2128 NTH2129 NTH2130NTH2131NTH2I33NTH2135
NTH2136 NTH213S NTH2142 NTH2145 NTH2146NTH2149NTH2150NTH2156
NTH2159 NTH2162 NTH2163 NTH2166 NTH2169NTH2170NTH2173NTH2181
NTH2183 NTH2187 NTH2191 NTH2193 NTH2195NTH2196NTH2197NTH2198
NTH2199 NTH2200 NTH2204 NTH2205 NTH2206NTH2207NTH2209NTH2213
NTH2216 NTH2217 NTH2219 NTH2220 NTH2221NTH2222NTH2223NTH2226
NTH2227 NTH2228 NTH2229 NTH2231 NTH2232NTH2234NTH2235NTH2242
NTH2243 NTH2245 NTH2247 NTH2250 NTH2251NTH2253NTH2256NTH2257
NTH2258 NTH2259 NTH2262 NTH2263 NTH2266NTH2269NTH2273NTH2274
NTH2277 NTH2282 NTH2284 NTH2285 NTH2287NTH2288NTH2291NTH2292
NTH2296 NTH2299 NTH2305 NTH2309 NTH2315NTH2316NTH2318NTH2323
NTH2324 NTH2326 NTH2327 NTH2330 NTH2332NTH2333NTH2342NTH2343
NTIT2344 NTH2346 NTH2347 NTH2349 NTH2352NTH2353NTH2356NTH2358
NTH2361 NTH2362 NTH2363 NTH2364 NTH2365NTH2368NTH2369NTH2370
NTH2371 NTH2376 NTH2377 NTH2381 NTH2382NTH2386NTPI2388KTH2394
NTH2398 NTH2402 NTH2405 NTH2406 NTH2407NTH2408NTH2414NTH2414
NTH2422 NTH2430 NTH2432 NTH2433 NTH2434NTH2438NTH2442MTH2447
NTH2448 NTH2451 NTH2455 NTH2456 NTH2457NTH2458NTH->460NTH2461
NTH2463 NTH2464 NTH2466 NTH2467 NTH2468NTH247iNTH2472NTH2478
NTH2480 NTH2481 NTH2482 NTH2483 NTH2484NTH2485NTH2486NTH2487
NTH2488 NTH2493 NTH2495 NTH2496 NTH2497NTH2498NTH2499NTH2500
NTH2501 NTH2505 NTH2508 NTH2510 NTH2524NTH2525NTH2527NTH2528
NTH2531 NTII2532 NTH2533 NTH2534 NTH2536NTH2537NTH254INTH2542
NTH2543 NTH2545 NTH2546 NTH2548 NTH2549NTH2550NTH2552NTH2554
NTH2556 NTH2557 NTH2558 NTH2562 NTH2563NTH2566NTH2567NTH2568
NTH2569 NTH2570 NTH2572 NTH2573 NTH2575NTH2577NTH2578NTH2584
NTH2585 NTH2587 NTH2588 NTH2590 NTH2591NTH2593NTEi2595NTH2597
NTH2600 NTH2602 NTH2603 NTH2604 NTH2605NTH2607NTH2608NTH2609
NTH2610 NTH2612 NTH2613 NTH2615 NTH2616NTH26I8NTH2626NTH2633
NTH2635 NTH2640 NTH2641 NTH2647 NTH2648NTH2649NTH2650NTH2655
NTH2661 NTH2663 NTH2664 NTH2667 NTH2668NTH2673NTH2674NTH2675
NTH2679 NTH2680 NTH2684 NTH2690 NTH2693NTH2694NTH2696NTH2697
NTH2701 NTH2702 NTH2703 NTH2704 NTH2705NTH2706NTH2707NTH2708
NTH2709 NTH2710 NTH2711 NTH2712 NTH2713NTH2715NTH2716NTH2718
NTH2719 NTH2720 NTH2721 NTH2723 NTH2724NTH2725NTH2/26NTH2727
NTH2729 NTH2730 NTH2731 "NTH2732 NTH2735NTH2737NTH2'38NTH2740
-37

WO 2005/111066PCT/IB2005/001775
NTH2743 NTH2744 NTH2749NTH2750 NTH2753 NTH2754 N1H2755 NTH2756
NTH2757 NTH2758 NTH2764NTH2765 NTH2769 NTH2774 NTH2777 NTH2778
NTH2779 NTH2781 NTH2783NTH2784 NTH2785 NTH2791 NTH2793 NTH2794
NTH2796 NTH2797 NTH2798NTH2804 NTH2806 NTH2807 NTH2809 NTH2810
NTH2813 NTH2814 NTH28I6NTH2823
TABLE III - Annotations
aa = length of polypeptide
PSORT - cellular location of polypeptide, according to PSORT algorithm

aa
PSORT
Annotation
0003
274
cytoplasm
Diammopimefate epimerase (dapF)
-00'07
61
cytoplasm
tldD protein tldD
0010
158
cytoplasm
transcriptiona! regulator

93
cytoplasm
usg 1 protein (usg1)

274
cytoplasm
excinuclease ABC subunit C (uvrC)
0014
64
periplasmic
excinuclease ABC, subunit C (uvrC)
0017
161
outer
2',3' cyclic nucleotide 2' phosphodiesterase (cpdB)
0018
130
cytoplasm
16s pseudoundylate 516 synthase (rsuA)
0019
98
inner 1
bicyclomycln resistance protein (bcr)
0020
181
inner 4
Na{+) translocating NADH qumone reductase, subunit
0023
110
cytoplasm
sigma E factor regulatory protein (rseB)
0025
195
inner 1
slgma E factor negative regulatory protein (mclA)
0026
157
cytoplasm
RNA polymerase sigma E factor (rpoE)
0027
100
cytoplasm
cell division protein (ftsQ)
0028'
37
cytoplasm
cell division protein (ftsA)
0029
34
cytoplasm
cell division protein (fteA)
0030
268
cytoplasm
aspartate ammonia ligase (asnA)
0039
311
cytoplasm
ADP heptose -LPS heptosyltransferase II (rfaF)
0043
194
inner 3
sodium dicarboxylate symporter protein
0044
79
cytoplasm
:erntin (rsgA)
0047
219
cytoplasm
heat shock protein (hslU) / ATP dependent Clp protease ATP binding subunit
.0048
55
inner 2
L lactate permease (IctP)
0049
90
pen plasm ic
transfemn binding protein orTonB dependent receptor
0055
92
cytoplasm
leat shock protein (hsiV)
0057
235
periplasmic
acid phosphatase
0058
206
cytoplasm
rod shape determining protein (mreB) or cell division protein FtsA ftsA
0059
54
periplasmic
rod shape-determining protein (mreC)
0060
104
inner 0
ribosomal protein S8 (rpS8)
0061'
313
inner 2
ribosomal protein L6 {rpL6)
i 0063'
257
cytoplasm
fumarate (and nitrate) reduction regulatory protein (fnr)
38-

WO 2005/111066

PCT/IB2005/001775

0065
266
cytoplasm
thiamin ABC transporter, periplasmic-bindmg protein (tbpA)
0067
86
inner 1
thiamm ABC transporter, permease protein
'0068
52
cytoplasm
UDP-N acetylenolpyruvoylglucosamme reductase (murB)
0066
149
cytoplasm
RNA polymerase sigma-32 factor {rpoH)
0070
127
cytoplasm
RNA polymerase sigma-32 factor (rpoH)
0071
64
cytoplasm
NifR3/SMM1 family protein
0072
201
cytoplasm
acetolactate synthase 111 large subunit (ilvl)
0073,
142
inner 1
acetolactate synthase III large subunit (ilvl)
0075
166
cytoplasm
acetolactate synthase III small subunit (ilvH)
0,078
119
cytoplasm
orotate phosphonbosyltransferase (pyrE)
00V9
36
cytoplasm
orotate phosphonbosyltransferase (pyrE)
0082
144
cytoplasm
DNA polymerase III, chi subunit (ho!C)
0083
85
cytoplasm
methylglyoxal synthase (mgsA)
0085
340
inner 7
cytochrome C type biogenesis protein (ccmF)
0086
45
cytoplasm
cytochrome C type biogenesis protein (ccmE)
,0087
312
cytoplasm
histidyl-tRNA synthetase (hisS)
_0088
214
cytoplasm
opoisomerase IV, subunit A (parC)
,0091,
212
inner 1
4-hydroxy 2 oxoglutarate
0094
338
lipo
zinc protease
0098
358
cytoplasm
lomoserme 0 acetyltransferase (met2)
0O99
60
cytoplasm
DNA gyrase, subunit A (gyrA)
0100
56
cytoplasm
DNA gyrase, subunit A {gyrA)
0102
102
cytoplasm
universal stress protein A (uspA)
0103
290
cytoplasm
alanyl tRNA synthetase (alaS)
0104
81
cytoplasm
atanyl tRNA synthetase {alaS)
'0105
557
cytoplasm
protective surface antigen D15 (Omp85)
,0106'
110
periplasmic
outer membrane protein
0167
257
inner 1
cell division protein (ftsZ)
0108
352
cytoplasm
cell division protein (ftsA)
0109
496
cytoplasm
DNA topoisomerase I (topA)
0112
259
cytoplasm
penicillin binding protein 1B (ponB)
0113
35
cytoplasm
penicillin binding protein 1B (ponB)
0115
279
cytoplasm
penicillin binding protein 1A (ponA)
0116
310
inner 1
GTP-binding protein
0117
243
cytoplasm
phosphomannomutase (yhxB)
0118
84
inner 0
phosphomannomutase (yhxB)
0119
89
periplasmic
ton B protein
0120
147
periplasmic
biopolymer transport protein (exbD)
0121
49
inner 1
biopolymer transport protein (exbB)
0126
77
cytoplasm
ntegrase/recombinase
0128
111
inner 1
xanthine guanine phosphonbosyltransferase (gptB)
0130"
184
cytoplasm
aminoacyl histidine dipeptidase (pepD)
0131
35
cytoplasm
aminoacyl histidine dipeptidase {pepD)
01-34,
182
inner 1
phosphonbosylglycinamide formyltransferase (purN)
-39-

WO 2005/111066

PCT/IB2005/001775

58
cytoplasm
GTP binding membrane protein (lepAJ

78
cytoplasm
uracil DNA glycosylase (ung.)
014iff
76
cytoplasm
atdose 1-epimerase (galM)
0,143'
129
cytoplasm
gaiactokinase (galK)
0144
197
cytoplasm
galactoKinase (galK)
0145
346
cytoplasm
GTP-bindmg protein TypA
0147
179
cytoplasm
queuinetRNA nbosyitransferase (tgt)
0150
239 | cytoplasm
rlbosoma! large subunit pssudoundme synthase C
0152:
463
cytoplasm
gaiactoside ABC transporter, ATP binding protein (mgiA)
0153
247
cytoplasm
hemagglutmin/hemoiysin related protein

240
cytoplasm
hemagglutlnln/hemolysln related protein
, 0155
302
inner 7
phosphate perrnease

124
inner 2
cytochrome D ubiquinol oxidase, subunit \ (cydA) or ronflll) ABC ranaporter, permease protein IbpB
0158'
103
inner 2
cytochrome D ubiqumo! oxidase, subyntt tl (cydB)
0163
154
lipo
15 KDa pepbdoglycan associated Ilpoprotem (ipp)
0165
165
cytoplasm
membrane-bound lytsc murem tmnsgiycosylass C (mltC)
0167
194
hpo
membrane-bound lytic muresn transglycosylase C (mltC)
0170
51
cytoplasm
hflK protein (hftK)
0174
40
periplasmic
asl specific protease (prc)
0178
116
cytoplasm
recombination protein (rec2) or competence protein ComA comA
0180
147
inner 2
ABC transporter, ATP-blndlng protein (msbA)
0185
220
inner 0
chonsmate synthase (aroC)
0186
156
inner 2
ATP binding transport protein (cydD)
0189
162
inner 2
oti shape-determining protein (mreD)
0190
188
periplasmic
rod shape determining protein (mreC)
0196
68
cytoplasm
Sigma factor
0200
68
cytoplasm
mercuric ion scavenger protein (merP)
'0201
68
cytoplasm
mercuric ion scavenger protein (merP)
0202
68
cytoplasm
mercuric ion scavenger protein (merP)
0203
63
inner 0
orfJ protein
0204
306
cytoplasm
penicillin binding protein 1A (ponA)
0205
38
cytoplasm
penicillin binding protein 1A (ponA)
0206
175
cytoplasm
extragentc suppressor (suhB)
0208.,
64
inner 1
cytochrome C type biogenesis
0209
117
inner 2
1,4 dihydroxy-2 naphthoate octaprenyltransferase (msnA)
0212
203
cytoplasm
lysyi tRNA synthetase analog (genX)
0215
s,
204
cytoplasm
fumarate reductase, flavoprotem subunit (frdA) or succmate dehvdroaenase flavoorotem subunrt sdhA
0216"
48
cytoplasm
fumarate reductase, ftavoprotein subunit (frdA) '
0217
40
cytoplasm
fumarate reductass, fSavoprotein subunit (frdA)
0218
31D
cytoplasm
nitrogen fixation protein (ntfRS)
0220
99
cytoplasm
Hin recombinatonal enhancer binding protein (fis) or factor for inversion stimulation protein Fis
0221
48
cytoplasm
small protein B (smpB)
-40-

WO 2005/111066

PCT/IB2005/001775

0222
222
cytoplasm
magnesium and cobalt transport protein (corA)
0223
91
inner 1
magnesium and cobalt transport protein (corA)
0225
426
cytoplasm
exorlbonuclease II (rnb) or nbonuclease II family protein vacB
0233,
114
cytoplasm
undylate kinase (pyrH)
0234
41
cytoplasm
urldylate kinase (pyrH)
0236*
35
cytoplasm
phospho 2-dehydro 3-deoxyheptonate aldolase (phenylalamne
0239
322
cytoplasm
heat shock (chaperone) protein (hscA)
. 0240
44
cytoplasm
heat shock (chaperone) protein (hscA)
0241
193
outer
usg-1 protein {usg1)
0243
268
inner 2
tryptophan synthase alpha subunit (trpA)
-0244
58
cytoplasm
tryptophan synthase beta subunit (trpB)
0244
245
periplasmic
stationary phase survival protein SurA or peptidyl prolyl cis trans isomerase
0245

191
cytoplasm
pynmidine operon regulatory protein (pyrR) or hypoxanthine guanine phosphonbosyltransferase,
0246
153
cytoplasm
mazG protein (mazG)
0247 ¦
159
inner 3
ATP synthase FO subunit a (atpB)
0249
203
cytoplasm
glucose-inhibited division protein (gidB)
0157
289
cytoplasm
selenocysteme specific elongation factor (selB)
0258
212
cytoplasm
pyruvate dehydrogenase, E1 component (aceE)
0259
61
cytoplasm
pyruvate dehydrogenase, E1 component (aceE)
0260
505
cytoplasm
nbonuclease E (rne)
0262
303
cytoplasm
ATP-dependent helicase (dmG)
0263
276
inner 7
thiamm ABC transporter, permease protein
0266
121
cytoplasm
N utilization substance protein B (nusB)
0267
160
cytoplasm
thiamm monophosphate kinass (thiL)
0268
144
cytoplasm
thiamin monophosphate kinass (thiL)
0269
163
inner 3
phosphatidylglycerophosphatase A (pgpA)
,0272
44
cytoplasm
ribosomal protein L34 (rpL34)
0273
119
cytoplasm
ribonuclease P (mpA)
,0275
146
cytoplasm
impA protein
0277
218
cytoplasm
phospho 2-dehydro 3 deoxyheptonate aldolase (phenyfalanine
0286
288
cytoplasm
GTP binding protein
0287
422
cytoplasm
formate dehydrogenase, beta subunit (fdxH) or ferredoxm, 4Fe 4S bacterial type
,0291
109
cytoplasm
mannonate dehydratase (uxuA)
0292
46
cytoplasm
mannonate dehydratase (uxuA)
0294,
171
cytoplasm
dihydroxyacid dehydratase (ilvD)
0295'
308
inner 1
threomne deammase (ilvA)
0296
239
cytoplasm
galactose 1 phosphate undylyltransferase (galT)
0303
283
cytoplasm
hemoglobin binding protein
0304
68
cytoplasm
ribosomal protein L24 (rpL24)
0305
123
cytoplasm
ribosomal protein L14 (rpL14)
0309
82
cytoplasm
inorganic pyrophosphatase (ppa)
0311
185
inner 4
phosphatidylglycerophosphate synthase (pgsA) or CDP-diacylglycerol-glycerol 3 phosphate
-41-

WO 2005/111066

PCT/IB2005/001775

274
cytoplasm
dihydrolipoamide dehydrogenase (IpdA) or pyruvate dehydrogenase, E3 component, lipoamide
0315
38
cytoplasm
dihydrolipoamide dehydrogenase (IpdA)
0318
358
cytoplasm
DNA topoisomerase III (topB) or DNAtopoisomerase I topA
0320
411
inner 1
Nqr6 subunit of Na translocating NADH quinone reductase
0321 i
191
inner 1
single stranded DNA binding protein (ssb)
0323
141
cytoplasm
exclnuciease ABC, subunrt A (uvrA)
0324
319
cytoplasm
type IV pilus assembly protein pilF
, 0325
200
inner 1
pilus assembly protein PilG pilG
0326
386
Inner 8
branched chain amino acid transport system II carrier
0329
395
cytoplasm
cystathiomne beta lyase (metC) or trans sulfuration enzyme family protein
0330
109
cytoplasm
sanA protein (sanA)
0333
96
inner 1
folylpolyglutamate synthase/dihydrofolate synthase (folC)
0336
133
cytoplasm
short chain dehydrogenase/reductase or oxidoreductase, short-chain dehydrogenase/reductase

391
cytoplasm
tryptophan synthase beta subunit (trpB)
0340 '
151
cytoplasm
cell division protein (ftsH)
0342
147
cytoplasm
peptide methionine sulfoxlde reductase pllB
0346
46
periplasmic
small protein A
0347'
273
Inner 7
transport protein
0349
66
cytoplasm
protease
0351
412
inner 1
penicillin binding protein 1B (ponB)
0352
291
inner 5
carbon starvation protein A cstA
0354
227
cytoplasm
GTP pyrophosphokinase (relA)
0355
367
cytoplasm
GTP pyrophosphokinase (relA)
0356
65
inner 1
diacylglycerol kinase (dgkA)
0358
56
inner 1
diacylglycerol kinase (dgkA)
0359
275
cytoplasm
esterase
0360
216
cytoplasm
UDP 3 0 (3 hydroxymynstoyl) glucosamine N acyltransferase
0361
141
cytoplasm
translation elongation factor Ts (tsf) (EF-TS)
0365
91
cytoplasm
exodeoxynbonuclease III (xthA)
0366
432
Inner 1
heme hemopexln utilization protein A (hxuA)
0367
184
cytoplasm
carboxy terminal tail specific protease (prc)
0368
204
cytoplasm
carboxy terminal tail specific protease (prc)
0369
163
cytoplasm
dihydroxyacid dehydratase (ilvD)
0370
201
cytoplasm
acetohydroxy acid synthase I! or acetolactate synthase III, large subunit llvl
,0372
306
inner 7
sodium dependent transporter or sodium and chloride dependent
ransporter
0373
42
cytoplasm
aminotransferase
0374
307
cytoplasm
aminotransferase
0376
128
cytoplasm
ribosomal protein L17 (rplQ)
0377
193
cytoplasm
DNA-directed RNA polymerase, alpha chain (rpoA)
0380
33
cytoplasm
acyineu ram mate cytidylyltransferase (neuA)
0382
359
cytoplasm
peptidyl prolyl cis trans isomerse
0386
111
cytoplasm
DNA gyrase, subunit A (gyrA)
-42-

WO 2005/111066

PCT/IB2005/001775

0387
52
cytoplasm
DNA gyrase, subunit A (gyrA)
0388
242
inner 3
sodium/prohne symporter (proline permease) (putP)
039r
256
cytoplasm
anaerobic ribonucleoside triphosphate reductase (nrdD)
0392
87
cytoplasm
anaerobic ribonucleoside triphosphate reductase (nrdD}
0393
211
cytoplasm
ammotransferase
0394
117
cytoplasm
aerobic respiration control protein ARCA (arcA) or DNA binding response regulator
0397
444
inner 8
thiol disulfide interchange protein {dsbD}
0399
362
cytoplasm
GTP binding membrane protein (lepA)
0400
437
inner 9
sodium dependent transporter
0401
206
inner 5
nitrite reductase, transmembrane protein (nrfD)
0402
138
inner 3
cytochrome C type biogenesis protein orthio! disulfide interchange protein DsbD dsbD
0403,
84
cytoplasm
peptide methionine sulfoxide reductase (msrA)
0405
299
periplasmic
peptide methionine sulfoxide reductase {msrA)
0418
297
inner 3
cytochrome D ubiqumol oxidase subunit I (cydA)
0421
287
periplasmic
CTP synthetase (pyrG)
0423
385
cytoplasm
exodeoxyribonuclease VII, large subunit (xseA)
0425
92
cytoplasm
oligopeptide ABC transporter ATP binding protein (oppD)
0426
311
inner 6
ollgopeptlde ABC transporter, permease protein (oppC)
0427
232
inner 6
oligopeptide ABC transporter, permease protein (oppB) or Iron(lll) ABC ransporter, permease protein
0428
316
cytoplasm
cysteme synthetase (cysK)
0431
116
cytoplasm
C 5 cytosine specific DNA methylase
0436-
341
cytoplasm
peptide chain release factor 3 (prfC)
0437
295
inner 1
enoy! (acyl carrier protein) reductase (fabl)
0441
66
cytoplasm
. 2 4 diaminobutyrate decarboxylase
0442
222
cytoplasm
ormamldopynmldlne-DNA glycosylase (fpg)
0443,
160
cytoplasm
peptidase T (pepT)
0444
178
inner 0
uculokinase (f*ck)
0447
323
cytoplasm
L fucose isomerase (fuel)
0448
119
cytoplasm
. fucose isomerase (fuel)
0449
193
cytoplasm
dethiobiotm synthase (bioD 1)
0451
88
cytoplasm
GTP cyclohydrolase I (folE)
0453
113
inner 1
GTP cyclohydrolase I (folE)
0454
78
cytoplasm
GTP cyclohydrolase I (folE)
0456
212
cytoplasm
protein Pll undylyl transferase (glnD)
04,57
288
inner 9
undecaprenyl phosphate alpha N acetylglucosaminyltransferase or phospho N acetylmuramoyl-pentapeptide transferase
0458
293
cytoplasm
penicillin tolerance protein (lytB)
0459
57
inner 1
ipoprotein signal peptidase (IspA)
0460
122
inner 1
ipoprotein signal peptidase (IspA)
,0461
433
inner 2
YhbX/YhjW/YijP/YjdB family protein
0462
107
inner 2
ransporter protein
0463
159
inner 3
ransporter protein
43-

WO 2005/111066

PCT/IB2005/001775

0454
349
cytoplasm
2' 3 cyclic-nucleotide 2' phosphodiesterase (cpdB)
0465;
73
inner 1
iron (chelated) ABC transporter, permease protein (yfeD)
04675
215
cytoplasm
transcriptional activator
0468
314
periplasmic
thiamine biosynthesis protein
0469
76
inner 1
ABC transporter permease protein
0470
328
cytoplasm
alanyl tRNA synthetase (alaS)
0472
122
cytoplasm
alany! tRNA synthetase (alaS)
,0473
89
Inner 0
phosphatidylsenne decarboxylase praenzyme (psd)
0,474
261
cytoplasm
glutathione reductase (gor) or 2-oxoglutarate dehydrogenase, E3 component,
0475
241
inner 5
phosphatidylgtycerophosphatase B (pgpB)
0476
119
cytoplasm
GTP cyclohydrolase II (nbA)
0477
153
cytoplasm
DNA polymerase III, delta subunit (holA)
0479
369
cytoplasm
glycyl tRNA synthetase beta chain (g!yS)
0480
305
cytoplasm
UDP-3 0 (3 hydroxymynstoyl) N acetylglucosamine deacetyiase
0481
116
cytoplasm
chorismate mutase / prephenate dehydratase (pheA)
0483
271
cytoplasm
urease accessory protein (ureH)
0490
179
inner 4
glutamate permease (gltS) sodium/glutamate symporter
0492
95
cytoplasm
nbosoma! protein S6 modification protein (rimK) or glutathione synthetase gshB

123
inner 2
Na+/H+ antiporter (nhaC)
0494
326
cytoplasm
xylose operon regluatory protein (xyiR)
0495
144
cytoplasm
ipopolysacchande biosynthesis protein or lacto N neotetraose biosynthesis glycosyl
0496
257
inner 1
ipopolysacchande biosynthesis protein
0502
46
outer
penicillin binding protein 7
0503
138
cytoplasm
ranscnption elongation factor (greA)
0504
115
outer
D alanyl D alanine
0505-
370
cytoplasm
D alanyl D alanine or penicillin binding protein 3
05063
38
cytoplasm
S1016 family transposase
0507
158
inner 1
S1016V6 protein (1S1016-V6)
0508
111
cytoplasm
S1016C2 transposase
05,14
296
cytoplasm
aminopeptidase A/I (pepA)
0515
113
cytoplasm
stringent starvation protein B (sspB)
0517
312
cytoplasm
1 deoxyxylulose 5-phosphate synthase fdxs)
0518 *
150
inner 0
short chain dehydrogenase/reductase
0519
348
cytoplasm
phosphonbosylaminoimidazole synthetase (purM)
0521
40
cytoplasm
phosphoglycerate mutase (gprnA)
0522
70
cytoplasm
nbosoma! protein L31 (rpL31)
0524
158
inner 0
A/G specific adenine glycosylase (mutY)
0525
86
cytoplasm
A/G specific adenine glycosylase {mutY}
6528
170
inner 2
ormate dehydrogenase gamma subunit (fdxl)
0529
319
inner 2
dhE protein (fdhE)
0530
137
cytoplasm
DNA transformation protein (sxy)
44-

WO 200S/111066

PCT/IB2005/001775

0535
b/1
cytoplasm
immunoglobin A1 protease (iga1) or hemagglutimn/hemolysin related protein
0535
289
cytoplasm
threonyl tRNA synthetase (thrS)
0540
184
cytoplasm
competence protein E (comE)
0542
213
cytoplasm
competence protein F (comF)
0543
220
cytoplasm
hflK protein (hflK) orstomatin/lVlec-2 family protein
0544
295
Inner 1
hfIC protein (hflC) or stomatin/Mec 2 family protein
0547
/4
periplasmic
sodium/proline symporter (prolme permease) (putP)
0548
3U4
cytoplasm
cytoplasmic axial filament protein (cafA)
05497
108
Inner 1
cytoplasmic axial filament protein {cafA}
0550

cytoplasm
cytoplasmic axial filament protein {cafA)
0552
217
cytoplasm
cell division protein (mukB)
0554
248
cytoplasm
killing protein suppressor (kicA)
0557
245
cytoplasm
dhD protein (ftfhD)
0558
38
cytoplasm
dhD protein (fdhD)
0560
30
cytoplasm
phosphatidylsenne decarboxylase proenzyme (psd)
0563
56
cytoplasm
ibosomal protein L32 (rpL32)
0564
225
cytoplasm
beta ketoacyl ACP synthase III (fabH) or 3 oxoacyl (acykamer protein) synthase III fabH
0565,
368
inner 7
ryptophan specific transport protein (mtr)
0566
409
inner 1
L serins deaminase (sdaA)
0571
292
cytoplasm
cytidmedeaminase(cdd)
0574
212
inner 2
poprotem
0575
65
cytoplasm
ranscrlptlonal regulator (bolA)
0576
158
cytoplasm
NADH ubiqulnone oxidoreducatase subunit A Na translocating or Na(+) translocating NADH quinone reductase, subunit
0580
160
inner 0
translation initiation factor 2 (infB)
0591
200
cytoplasm
beta phosphoglucomutase pgmB
0592
467
cytoplasm
cell division protein (mukB)
0594
393
cytoplasm
raN-related protein
0595
3T
cytoplasm
GTP cyclohydrolase II (nbA)
0596
57
cytoplasm
GTP cyclohydrolase II (nbA)
0597
345
cytoplasm
oligopeptide transporter, periplasmic binding protein
0599
32
cytoplasm
oligopeptide transporter periplasmic-bindmg protein
0601
240
cytoplasm
aminopsptidase P (pepP)
0604
37
cytoplasm
aldose 1 epimerase (galM)
0605
19R
cytoplasm
aldose 1 epimerase (galM)
0607
318
cytoplasm
C 5 cytosme specific DNA methylase
0608
104
cytoplasm
ailing protein (kicB)
0609
144
cytoplasm
DNA polymerase III, delta subunit (holA)
0611
69
cytoplasm
are lipoprotem B
0613
75
cytoplasm
transcriptional regulator (nadR)
0614
310
cytoplasm
transcriptional regulator (nadR)
0616
69
cytoplasm
aerobic respiration control protein ARCA (arcA)
0618
368
inner 7
sodium/alanine symporter
-45-

WO 2005/111066

PCT/IB2005/001775

0619
303
periplasmic
elongation factor Tu (tufB)
0622
218
inner 4
dedA protein
0626
164
inner 5
lic 1 operon protein (licB)
0627
321
cytoplasm
lic 1 operon protein (licA)
06281
235
cytoplasm
UDP N acetylenolpyruvoylglucosamine reductase (nwB)
0629
179
cytoplasm
nitrate/nitrite sensor protein (narQ)
0630

151
inner 1
small major protein B (smpB)
0632
53
cytoplasm
6 phosphofmctokinase (pfkA)
0633
290
__ cytoplasm
6 phosphofructokmase (pfkA)
0635
355
cytoplasm
type I modification enzyme (hsdM)
0636
158
inner 2
cystelne synthetase (cysZ)
0638
328
outer
cell division protein ZipA
0640.
122
cytoplasm
ribosomal protein S12 (rps12)
0641
346
cytoplasm
glucose inhibited division protein (gidA)
0646
257
inner 5
Na+/H+ antiporter (nhaC)
"0647
37
outer
Na+/H+ antiporter (nhaC)
0648
362
outer
colicm tolerance protein (tolB)
0650
497
cytoplasm
cell division protein (mukB)
0651
391
cytoplasm
heme binding lipoprotein (dppA)
0652
78
cytoplasm
octaprenyl diphosphate synthase (ispB)
0654
103
inner 1
ribosomal protein L21 (rpL21)
0655-
85
cytoplasm
ribosomal protein L27 (rpl_27)
0657
83
cytoplasm
GTP binding protein (yhbZ)
0658
75
inner 1
ipopolysacchande biosynthesis protein
0659
55
cytoplasm
ipopotysacchande biosynthesis protein
0660
255
cytoplasm
molybdenum transport protein (modE)
06661
34
periplasmic
molybdenum ABC transporter, periplasmic binding protein
06665
144
cytoplasm
single stranded DNA binding protein (ssb)
0670
366
cytoplasm
hlstidlnol phosphate amlnotransferase (hisH)
0671
31
cytoplasm
phosphoserme ammotransferase (serC)
0672
31
cytoplasm
phosphosenne ammotransferase (serC)
0674,
140
cytoplasm
ribosomal protein L3 {rpL3)
0675
200
inner 1
ribosomal protein L4 (rpL4)
0676
139
inner 1
ribosomal protein L23 (rpL23)
0679
51
cytoplasm
ampD signalling protein (ampD)
0682
96
cytoplasm
hemolysin
0084
208
cytoplasm
spermidine/putrescine ABC transporter, ATP-bindmg protein
0685
52
cytoplasm
ysyWRNA synthetase analog (genX)
0686,
227
cytoplasm
DNA binding response regulator (cpxR)
0688
258
cytoplasm
aminoacyl histidine dipeptidase (pepD)
0689
185
cytoplasm
ntegrase/recombtnase (xerC)
0698
399
cytoplasm
nifS protein
0699
51
cytoplasm
nuclease
0701
153
cytoplasm
DnaA related protein
-46-

WO 2005/111066

PCT/IB2005/001775

0702
279
inner 7
uracil permease (uraA)
0703
129
inner 3
uracil permease (uraA)
0704
135
cytoplasm
uracil phosphonbosyltransferase (upp)
0705
341
cytoplasm
glutammyl tRNA synthetase (glnS)
0708
78
cytoplasm
cytoplasmic axial filament protein (cafA)
0709
258
inner 5
anaerobic C4 dicarboxylate membrane transporter protein
,0710
43
inner 1
anaerobic C4 dicarboxyiate membrane transporter protein
0714
169
cytoplasm
protein export protein (secB)
0718
175
inner 1
glucose inhibited division protein (gidA)
0719
224
cytoplasm
threonyl tRNA synthetase (thrS)
0720
194
cytoplasm
acyl carrier protein phosphodiesterase (acpD)
0723
146
cytoplasm
DNA topoisomerase I (topA)
0732
200
cytoplasm
recombination protein RecR (recR)
0733
202
cytoplasm
DNA topoisomerase 111 (topB)
0734
322
cytoplasm
S adenosylmethiomne synthetase (rnetX)
0735
193
cytoplasm
anthranilate synthase component II (trpG) or para aminobenzoate synthase glutamine
0736
210
cytoplasm
para aminobenzoate synthetase component
, 0737
118
cytoplasm
olylpolyglutamate synthase/dihydrofolate synthase (folC)
0738
184
periplasmic
acetyl CoA carboxylase, carboxyl transferase subunit beta
0739
93
cytoplasm
acetyl CoA carboxylase carboxyl transferase subunit beta
0740
177
Inner 1
periptasmic serine protease
0741
321
cytoplasm
periplasmic serme protease
0743
269
cytoplasm
RNA pseudoundylate synthase I (truA)
0745
235
inner 2
peptide ABC transporter ATP binding protein (sapF)
0747
37
cytoplasm
peptide ABC transporter, ATP binding protein (sapF)
0748
44
cytoplasm
peptide ABC transporter, ATP binding protein (sapD)
0751
86
cytoplasm
pseudourldine synthase RluD (rluD)
0753
198
cytoplasm
RNA (guanlne N1) methyltransferase (trmD)
0754
116
cytoplasm
ribosomal protein L19 (rpL19)
,0758
235
cytoplasm
ribosomal protein S3 (rpS3)
0759
110
cytoplasm
ribosomal protein L22 (rpL22)
?0760
91
cytoplasm
ribosomal protein S19 (rpS19)
0761
180
cytoplasm
nbosomat protein L2 (rpL2)
0762
221
inner 5
protein export membrane protein (secD)
,0764
406
inner 1
protein export membrane protein (secD)
,0765
97
inner 1
preprotein translocase, YajC subunit (yajC)
0769
37
cytoplasm
queume tRNA nbosyltransferase (tgt)
,0770
371
cytoplasm
RNA
0772
55
cytoplasm
thiamine biosynthesis lipoprotem ApbE lipoprotein
0773
35
cytoplasm
ipoprotein
0774
299
inner 1
hiamine biosynthesis lipoprotem ApbE lipoprotein
'0777
63
cytoplasm
ribosomal protein L29 (rpL29)
,,0778
74
cytoplasm
ribosomal protein L16 (rpL16)
-47-

WO 2005/111066

PCT/IB2005/001775

0779
335
cytoplasm
dihydrolipoamide acetyltransferase (aceF) orpyruvate dehydrogenase, E2 component,
0781
35
cytoplasm
dihydrolipoamide acetyltransferase (aceF)
,0782
549
cytoplasm
pyruvate dehydrogenase E1 component (aceE)
0787
297
cytoplasm
glycme cleavage system transcriptional activator (gcvA) or transcriptional regulator, LysR family
0788
159
outer hand
penicillin-binding protein 1A (ponA)
0790
164
cytoplasm
competence protein A (comA)
0794
168
inner 1
competence protein B (comB)
0795
134
inner 1
competence protein C (comC)
0796
172
inner 1
competence protein D (comD)
0798
166
Inner 1
competence protein E (comE)
O801
583
cytoplasm
argmyl tRNA synthetase (argS)
0802
100
inner 1
glutaredoxm (grx)
,0803
406
inner 0
beta ketoacyl ACP synthase I (fabB)
0804
137
inner 1
monofunctional biosynthetic peptidoglycan transglycosylase
0805
101
cytoplasm
rp operon repressor (trpR)
0806
305
cytoplasm
soluble lytic murem transglycosylase
0807
267
cytoplasm
2 hydroxyacid (glycerate) dehydrogenase
0808
30
cytoplasm
2 dehydro 3-deoxyphosphooctonate aldolase (kdsA)
0810
249
cytoplasm
2 dehydro 3-deoxyphosphooctonate aldolase (kdsA)
0712
84
cytoplasm
hemK protein (hemK)
,0013
202
inner 1
hemK protein (hemK)
0817*
411
cytoplasm
lydrolase
0821
240
inner 1
ranscnptional regulatory protein (ygiX)
0822
154
inner 1
sensor protein (ygiY)
0823
66
cytoplasm
sensor protein (ygiY)
0824
316
cytoplasm
glutamyl-tRNA synthetase (gltX)
0825
80
cytoplasm
giutamyl-tRNA synthetase (gltX)
0826
79
cytoplasm
glutamyl tRNA synthetase (gltX)
0828
45
cytoplasm
nbonuclease PH (rph)
0829
278
inner 1
amidophosphonbosyltransferase(purF)
0830
484
cytoplasm
DNA gyrase, subunit A (gyrA)
0831
54
cytoplasm
DNA gyrase, subunit A (gyrA)
0833
583
cytoplasm
hemin receptor (hemR) or iron-regulated outer membrane protein FrpB frpB
'0834
143
Inner 2
colicm transport protein (tolQ) or biopolymer transport protein ExbB exbB
0835
139
periplasmic
colicin transport protein (toIR) or biopolymer transport protein ExbD exbD
0836
337
inner 1
outer membrane integrity protein (tolA) or IgA specific sorine endopeptidase iga
0840
76
cytoplasm
ABC transporter ATP-bindmg protein
0842
31
cytoplasm
ype 1 restriction enzyme (hsdR)
0844
53
cytoplasm
modification methylase
0845
184
cytoplasm
ADP heptose synthase (rfaE) or aut protein aut
0847
389
cytoplasm
argminosuccmate lyase (argH)
48

WO 2005/111066

PCT/IB200S/001775

0848
295
periplasmic
glucosephosphate undylyltransferase (galU) or UTP-glucose-1 -phosphate undyiyltransferase galU
0849
63
periplasmic
carbon storage regulator (csrA)
085O
461
inner 4
ATP binding protein protein (cydD)
0851
94
inner 2
ATP binding protein protein (cydD)
0852
160
inner 1
NAD(P)H oxidoreductase
0856
133
periplasmic
protease IV (sppA)
0857
162
cytoplasm
molybdenum ABC transporter, periplasmic-bmding protein
0858
.
242
Inner 5
molybdenum ABC transporter, permease protein (modB) or sulfate ABC transporter, permease protein cysT
0859
40
cytoplasm
molybdenum ABC transporter ATP binding protein (modC)
0860
24b
cytoplasm
molybdenum ABC transporter, ATP binding protein (modC) or sulfate ABC ransporter, ATP binding protein cysA
0868
119
cytoplasm
ype I restriction/modification specificity protein (hsdS)
0869
90
cytoplasm
anthramlate synthase component I trpE
0873
145
cytoplasm
phosphoserme aminotransferase (serC)
0874
234
inner 2
succinyl CoA synthetase, beta subunit (sucC)
0875
293
inner 1
succinyl CoA synthetase, alpha subunit (sucD)
0882
93
cytoplasm
mazG protein (mazG)
.0887
285
inner 1
3 oxoacyl (acyl-carner protein) reductase fabG 2
0696
153
cytoplasm
DNA polymerase III delta' subunit (ho!B)
0892
41
cytoplasm
hlol disulflde interchange protein (dsbD)
0893
60
cytoplasm
hiol disulfide interchange protein (dsbD)
0897
234
cytoplasm
phosphonbosylaminosmidazolecarboxarnideformyltransferase
0898
552
cytoplasm
ATP dependent RNA helicase DeaD (deaD)
0900
64
cytoplasm
type I restriction/modification specificity protein (hsdS)
0903
248
cytoplasm
ype I restriction enzyme (hsdR)
'0905
106
cytoplasm
2-Isopropylmalate synthase (leuA)
0907
373
cytoplasm
DNA processing chain A (dprA)
0910
106
periplasmic
mtnte reductase, Fe S protein (nrfC)
0912
fifl
cytoplasm
nitrite reductase, cytochrome C type protein (nrfB)
0913
?77
inner 1
cell division protein FtsK related protein
0914
205
outer
outer membrane lipoproteins earner protein (lolA)
0918
?in
cytoplasm
glycogen phosphorylase (glgP)
0919
323
cytoplasm
glycogen phosphorylase (glgP)
0920
117
cytoplasm
glycogen phosphorylase (glgP)
0923
253
cytoplasm
glycogen synthase (glgA)
6925
105
cytoplasm
phosphoglycerate mutase (gpmA)
0934
242
cytoplasm
3-ketoacyl-acyl earner protein reductase (fabG)
0936
48
cytoplasm
malonyl CoA acyl carrier protein transacvlase (fabD)
0936
222
cytoplasm
malnnyl OnA anyl carrier protein transacvlase (fabD)
0939
111
cytoplasm
3-oxoacyI (acyl-camer protein) synthase III fabH
0945
125
cytoplasm
molybdoptenn biosynthesis protein (moeB) orthiF protein thiF
0946
404
cytoplasm
molybdoptenn biosynthesis protein (moeA)
0947
55
cytoplasm
GTP cyclohydrolase I (folE)
-49-

WO 2005/111066

PCT/ffi2005/001775

'0950
353
inner 2
protease (sohB)
0954
274
cytoplasm
recombination associated protein RdqC rdgC
'0956
354
cytoplasm
adenosylmethiomne 8 amino 7-oxononanoate ammolransferase
'0958,
379
cytoplasm
8-amino 7-oxononanoate synthase (bioF)
096d
80
cytoplasm
ABC transporter, ATP binding protein
'0962
66
cytoplasm
ABC transporter ATP binding protein
,0963,
317
cytoplasm
ABC transporter ATP binding protein (msbA)
0965
313
cytoplasm
tetraacyldisacchande 4 -kinase IpxK
0966
254
cytoplasm
3-deoxy D manno octulosonate cytidylyltransferase (kdsB)
0967
77
cytoplasm
excinuclease ABC, subunit C (uvrC)
0969
204
cytoplasm
ABC transporter ATP binding protein
0974
90
cytoplasm
dethiobiotin synthase (bioD 2)
-0976
223
cytoplasm
biotin synthesis protein BioC
0977
549
cytoplasm
long chain fatty acid coA ligase
0983
574
cytoplasm
phosphoenolpyruvate carboxylase (ppc)
,0584.
303
cytoplasm
gcpE protein (gcpE)
0988
226
cytoplasm
rbs represser (rbsR)
0989
322
inner 1
nbokinase (rbsK) or ADP heptose synthase
0990
156
cytoplasm
D-ribose ABC transporter, periplasmic binding protein (rbsB)
0992
223
cytoplasm
saseplate assembly protein V
0994
52
inner 0
adhesin/invasm
0997
454
iipo
multidrug efflux pump channel protein mtrE
1001
273
cytoplasm
transcription termination factor (rho)
1002
230
inner 5
type 4 prepilln like protein specific leader peptidase
1003
143
inner 1
pilus assembly protein PilG pilG
1007
39
cytoplasm
glycerol 3-phosphate regulon repressor (glpR)
1008
306
cytoplasm
fructose 1,6 bisphosphatase (fbp)
1012
233
inner 8
hydroxyacylglutathione hydrolase
1014
182
cytoplasm
tellunte resistance protein (tehB)
1015
541
periplasmic
oligopeptide ABC transporter periplasmic binding protein
1018
45
periplasmic
ohgopeptide ABC transporter, permease protein (oppB)
1019
256
cytoplasm
methylenetetrahydrofolate
1021
428
inner 0
L fucose permease (fucP) or giucose/galactose transporter gluP
1022
216
cytoplasm
L fuculose phosphate aldolase (fucA)
1023
144
cytoplasm
fucose operon protein (fucU)
1024
30
cytoplasm
fuculokmase (f*ck)
1030
492
cytoplasm
anaerobic glycerol 3-phosphate dehydrogenase, subunit A
1031
320
inner 1
anaerobic glycero! 3 phosphate dehydrogenase subunit B
1032
242
inner 5
transporter
1033
116
cytoplasm
arsenate reductase
1041
70
cytoplasm
hypoxanthine phosphonbosyltransferase (hpt)
1043
460
inner 9
proton glutamate symport protein or sodium/dicarboxylate symporter family protein
1045
155
cytoplasm
anaerobic ribonucleoside triphosphate reductase activating
-50-

WO 200S/;lll066

PCT/TB2005/001775

1040
242
cytoplasm
transport ATP binding protein (cydC) ABC transporter
1048
212
inner 4
transport ATP binding protein (cydC)
1050
359
cytoplasm
fructose blsphosphate aldolase (fba)
1051
346
cytoplasm
ADP heptose-LPS heptosyltransferase II rfaF
1053
56
cytoplasm
peptidyi prolyl cis trans isomerse
1054
201
outer
peptidyl-prolyl cis trans isomerse
1057
452
cytoplasm
thiophene and furan oxidation protein (thdF)
10256
224
inner 2
nner membrane protein, 60 kDa (yidC)
1059,
58
cytoplasm
ribosomal protein S18 (rpS18)
1060
149
cytoplasm
nbosomai protein L9 (rpL9)
1061
577
cytoplasm
heat shock protein (groEL)
1062
102
cytoplasm
chaperonm (groES)
1063
190
inner 4
urease, gamma subunit (ureA)
1064
216
inner 5
rod shape determining protein (rodA) or cell division piotein FtsWftsW
1066
66
cytoplasm
penicillin-binding protein 2 (pbp2)
1068
66
cytoplasm
cell division protein FtsK related protein
1071
447
cytoplasm
protease IV (sppA)
1074
286
cytoplasm
ic 1 operon protein (licD)
1075
213
outer
aminopeptidaseA/l (pepA)
1077
141
cytoplasm
nucleoside dlphosphate kinase (ndk)
1078
227
cytoplasm
GTP binding protein (yhbZ)
1080
317
inner 1
phosphonbosylamme-glycine ligase (purD)
1081
198
cytoplasm
phosphoribosylaminoimidazolecarboxamideformyltransferase
1082
31
outer
phosphonbosyiammoimidazolecarboxamideformyltransferase
1083
45
inner 0
phosphonbosylaminoimidazolecarboxamideformyltransferase
1084
199
inner 0
sufl protein (sufl)
1085
125
inner 1
1 acyl-glycerol 3 phosphate acyltransferase (pIsC)
1087
75
inner 1
1 acyl glycerol 3 phosphate acyltransferase (plsC)
1091
199
inner 4
sodium and chloride dependent transporter
1092
217
inner 2
potassium/copper transporting ATPase
1O93
68
cytoplasm
mercuric ion scavenger protein (merP)
1094,
68
cytoplasm
mercuric ion scavenger protein

1095
68
cytoplasm
mercuric ion scavenger protein (merP)
1096
144
cytoplasm
transcription al regulator, merR family
1097
105
cytoplasm
met repressor (metJ)
1098
109
inner 1
ranscnption termination factor (rho)
1100
317
cytoplasm
fumarate reductase fiavoprotein subunit (frdA) or succinate dehydrogenase fiavoprotein subunit sdhA
1101
276
cytoplasm
umarate reductase iron sulfur protein (frdB) or succinate dehydrogenase ran sulfur protein sdhB
1102
132
inner 3
fumarate reductase, 15 kDa hydrophobic protein (frdC)
1103
114
inner 1
fumarate reductase 13 kDa hydrophobic protein (frdD)
1109
170
cytoplasm
erminase small subumt
1116
51
cytoplasm
heme-hemopexin utilization protein A (hxuA)
1117
165
cytoplasm
leme-hemopexin utilization protein A (hxuA)
-51-

WO 2005/11:1066

PCT/IB2005/001775

1120
118
cytoplasm
dihydroneoptenn aldolase (folB)
1124
338
inner 1
nrtrate/mtnte sensor protein (narQ)
1125
225
inner 1
topolsomsrase IV, subunit A (parC)
1127
139
cytoplasm
glucose kinase
1132
202
cytoplasm
type 1 modification enzyme (hsdM)
1135
260
cytoplasm
type 1 modification enzyme (hsdM)
1137
362
cytoplasm
type 1 restriction/modification specificity protein (hsdS)
1138
226
inner 0
thiamin phosphate pyrophosphorylase
1139
254
cytoplasm
phosphomethylpynmidine kinase (thlD)
1140
32
cytoplasm
phosphomethylpynmidme kinase (thiD)
1141
263
inner 1
hydroxyethylthiazole kinase
1143
70
cytoplasm
outer membrane protein NsgA
1 144 ,
51
cytoplasm
nbonuclease E (rne)
1145
75
cytoplasm
ribonuclease E (me)
1148
42
cytoplasm
nbonuclease E (rne)
1151
180
inner 1
ademne phosphonbosyltransferase (apt)
1152
311
cytoplasm
DIMA polymerase III, subunits gamma and tail (dnaX)
1154
221
cytoplasm
DNA polymerase ill, subunits gamma and tau (dnaX)
1155
173
cytoplasm
DNA polymerase III subunits gamma and tau (dnaX)
1156
60
cytoplasm
uracil phosphonbosyitransferase (upp)
1165
406
cytoplasm
mfS protein (mfS)
1166
151
cytoplasm
scU protein (iscU)
1167
107
cytoplasm
HesB/YadR/YfhF family protein
1168
174
cytoplasm
co-chaperone Hsc20 (hscB)
1171
151
cytoplasm
leat shock protein (hscA)
1172
53
cytoplasm
3 lactate dehydrogenase (did)
1173
36
cytoplasm
ype 1 restriction enzyme EcoR124ll R protein,
1174
183
lipo
poprotem (spr)
1175
194
cytoplasm
Id D protein tldD
1177
44
cytoplasm
lemoglobin binding protein
1180
234
cytoplasm
peptidase E (pepE)
1182
386
cytoplasm
ibosomal protein S1 (rpS1)
'1183
94
cytoplasm
ntearation host factor, beta subunit (himD)
1186,
194
cytoplasm
orotidine 51 phosphate decarboxylase (pyrF)
l188
181
inner 1
ipopolysacchande biosynthesis protein
1189
264
inner 1
alpha-1,2 N acetylglucosamme transferase rfaK
1190
57
periplasmic
ipopolysacchande biosynthesis protein
1191
304
inner 2
alpha-23 sialyltransferase
1192
160
inner 4
ipopolysacchande biosynthesis protein
1197
124
cytoplasm
undine kinase (udk)
1198
195
cytoplasm
deoxycytidlne triphosphate deaminase (dcd)
1201
402
inner 10
drug resistance translocase family protein
1202
158
cytoplasm
GTP-binding protein
1203
55
outer
hemoglobin binding protein
-52-

WO 2005/111066

PCT/IB2005/001775

1206
736
cytoplasm
TonB dependent receptor or hemoglobin receptor hmbR
1207
91
cytoplasm
transcriptional regulator, HTH 3 family
1212
230
cytoplasm
glycyl tRNA synthetase, beta chain (glyS)
1218
244
cytoplasm
glycyMRNAsynthetase, alpha chain (glyQ)
1228
198
cytoplasm
seryl tRNA synthetase (serS)
1229
282
inner 2
cytochrome C-type biogenesis protein (nrfF)
1230
176
inner 1
thiol disulfide interchange protein (dsbE)
1231
507
inner 9
cytochrome C type biogenesis
1233
380
inner 1
glutamate dehydrogenase (gdhA)
1242
135
cytoplasm
transcriptional regulator
1253
266
cytoplasm
transcriptional regulatory protein
1254
101
inner 3
galactoside ABC transporter permease protein (mgIC)
1256
185
Inner 6
ntracellularseptation protein A ispA
1258
154
cytoplasm
acyl CoA thioesterhydrolase family protein
1261
158
periplasmic
soluble lytic murein transglycosylase
'1263
229
cytoplasm
pyridoxamine phosphate oxidase (pdxH)
1264
162
cytoplasm
GTP binding protein
1266
69
cytoplasm
NAD(P)H flavin oxidoreductase
1267
386
cytoplasm
ATP binding protein (mrp)
1268
460
periplasmic
methionyl tRNA synthetase (metG)
1269
70
cytoplasm
phosphoribosylaminoimidazole carboxylase, catalytic
1272
596
cytoplasm
aminopeptidase N (pepN)
1273
175
inner 1
dihydrodipicolmate reductase (dapB)
1274
82
cytoplasm
ferredoxin
1276
329
cytoplasm
phenylalanyl tRNA synthetase, alpha subunit (pheS)
1277
373
cytoplasm
phenylalanyl tRNA synthetase, beta subunit (pheT)
1278
286
cytoplasm
DNA ademne methylase (dam)
1279
298
inner 1
3 dehydroquinate synthase (aroB)
1280
74
inner 2
NADH ubiquinono oxidoreductase, Na translocating
1281
208
inner 6
NADH ubiqumone oxidoreductase Na translocating
1282
269
inner 1
NADH ubiquinone oxidoreductase Na translocating
1283
411
inner 7
NADH ubiquinone oxidoreductase, subunit B (nqrB)
1284
48
cytoplasm
NADH ubiquinone oxidoreducatase subunit A, Na translocating
1285
254
cytoplasm
NADH ubiquinone oxidoreducatase subunit A, Na translocating
1286
85
inner 1
nitrogen fixation protein (rnfG)
1287
358
inner 9
Na(+) translocating NADH quinone reductase, subunit
1290
679
outer
ferredoxm, 4Fe-4S bacterial type
1291
58
cytoplasm
ferredoxin, 4Fe-4S bacteria! type
1295
406
inner 1
polynbonucleotide nucleotidyltransferase pnp
1297
296
inner 1
polynbonucleotlde nucleotidyltransferase pnp
1302
452
inner 1
O succinylbenzoate CoA ligase (menE) or long chain fatty acid-CoA igase fadD 2
1303
201
cytoplasm
seqA protein (seqA)
1304
85
cytoplasm
esterase/lipase
-53-

WO 2005/111066

PCT/IB2005/001775

1305'
65
inner 1
esterase/lipase
1306
144
inner 0
esterase/lipase
1307
41
inner 1
iron (chelated) ABC transporter, permease protein (yfeD)
.1308
147
inner 2
iron (chelated) ABC transporter, permease protein (yfeD}
1309
282
inner 8
iron (chelated) ABC transporter permease protein (yfeC)
1310
306
cytoplasm
iron (chelated) transporter, ATP binding protein (yfeB)
1311
293
periplasmic
iron (chelated} ABC transporter, periplasmic binding protein
1313
154
lipo
outer membrane integrity protein (toIA) or IgA specific serine endopeptidase iga
1314
253
cytoplasm
penicillin binding protein 7
1318
41
cytoplasm
transcriptional activator (iIvY)
1319
292
Inner 9
rarD protein
1320
105
cytoplasm
glpE protein (glpE)
'1321
263
inner 1
triosephosphate isomerase (tpiA)
1323
107
cytoplasm
ntegrase/recombinase (xerC)
1324
100
cytoplasm
dnaK suppressor protein (dksA)
1326
58
cytoplasm
poly(A) polymerase (pcnB)

450
inner 10
C4 dicarboxylate transporter
1331
131
cytoplasm
uracil DMA glycosylase (ung)
1332
124
inner 2
bicyclomycin resistance protein (bcr)
1338
50
cytoplasm
gamma glutamyl phosphate reductase (proA)
1339
47
cytoplasm
gamma glutamyl phosphate reductase (proA)
1340
39
cytoplasm
gamma glutamyl phosphate reductase (proA)
1341
319
inner 1
gamma glutamyl phosphate reductase (proA)
1343
98
cytoplasm
heat shock protein (dnaJ}
1344;
133
cytoplasm
acetyl CoA carboxyiase biotin carboxyl carrier protein
1345
443
cytoplasm
acetyi CoA carboxyiase biotin carboxyiase (accC)
1348
320
inner 7
sodium/pantothenate symporter (panF)
1349
493
cytoplasm
cell division protein (ftsH)
1351
201
cytoplasm
dihydropteroate synthase (folP-2)
1352
445
cytoplasm
mrsA protein (mrsA) or phosphoglucomutase/phosphomannomutase family
1355,
438
cytoplasm
DNA-directed RNA polymerase, beta1 chain (rpoC)
1357
172
inner 2
rod shape determining protein (rodA)
1359
621
inner 1
penicillin binding protein 2 (pbp2)
1361
193
cytoplasm
modification methylase NIalV
1363
432
inner 1
3 phosphoshiklmate 1-carboxyvmyltransferase (aroA) or 3
1365
298
inner 1
formyltetrahydrofolate deformylase (purU) or phosphonbosylglycinamide formytfransferase purN
1366
138
cytoplasm
DNA binding protein H NS (hns)
1369
66
cytoplasm
DNA polymerase III, alpha subunit (dnaE)
1370
35
cytoplasm
DNA polymerase III alpha subunit (dnaE)
1371
847
cytoplasm
DNA polymerase III, alpha subunit (dnaE)
1373
118
cytoplasm
hreonine deaminase (ilvA)
1378 '
196
cytoplasm
VfutT/nudix family protein
1379-
382
inner 1
glutamate 5 kinase (gamma giutamyl kinase) (proB)
-54-

WO 2005/111066

PCT/IB2005/001775

1380
128
inner 0
dihydrofolate reductase (folA)
1381
46
cytoplasm
dihydrofolate reductase (folA)
1382
392
inner 2
multidrug resistance protein A (emrA) or fatty acid efflux system protein farA
1384
343
cytoplasm
poly(A) polymerase (pcnB)
1386
106
cytoplasm
2 amino-4-hydroxy 6-hydroxymethyldihydroptendine
1388
432
periplasmic
N acetylmuramoyl L alanlne amldase
1399
227
cytoplasm
DNA mismatch repair protein (mutL)
1392
247
cytoplasm
iemY protein (hemY)
1393'
175
inner 1
hemY protein (hemY)
1394
377
periplasmic
uroporphyrm III C methyitransferase (hemX)
1398
194
Inner 0
transcnptonal activator (ilvY)
1400
492
inner 1
tetol acid reductoisomerase (ilvC)
1401
426
cytoplasm
anaerobic glycerol 3 phosphate dehydrogenase, subunit C
1402
30
cytoplasm
tRNA (guanine N1) methyitransferase (trmD)
1403
59
cytoplasm
16S rRNA processing protein RimM rimM
1404
81
cytoplasm
16S rRNA processing protein RimM nmM
1405
82
cytoplasm
ribosomal protein S16 (rpS16)
1407
603
periplasmic
5r nucleotidase
1408
128
cytoplasm
shikimic acid kinase I (aroK)
1410
249
cytoplasm
stationary phase survival protein (surE)
1411
128
inner 2
ipoprotein B (ippB)
1412
74
inner 1
ipoprotein B (IppB)
1416
354
llpo
ipoprotein NIpD
1417
56
cytoplasm
ipoprotein NlpD
1420
62
inner 1
phosphate ABC transporter permease protein (pstC)
1421
282
inner 5
Phosphate ABC transporter, permease protein (pstA) or sulfate ABC ransporter, permease protein cysT
1422
255
cytoplasm
amino acid ABC transporter ATP binding protein or sulfate ABC ransporter ATP binding protein cysA
1423
154
cytoplasm
phosphate regulon transcriptional regulatory protein (phoB) or DNA binding
response regulator NULL
1 424
72
cytoplasm
phosphate regulon transcnptionat regulatory protein (phoB)
1425
425
inner 1
phosphate regulon sensor protein (phoR) or sensor histidine kinase NULL
1426
44
cytoplasm
exodeoxynbonuclease I (sbcB)
1427
474
inner 1
exodeoxynbonuclease I (sbcB)
1428
158
inner 1
ammopepttdase A/i (pepA)
1429
480
inner 5
high affinity choline transport protein (betT)
1430
132
inner 2
high affinity choline transport protein (betT)
1431
57
inner 0
sensor protein (ygiY)
1432
139
cytoplasm
high affinity ribose transport protein (rbsD)
1433
493
cytoplasm
D ribose ABC transporter, ATP binding protein (rbsA)
1434
323
inner 9
D ribose ABC transporter, permease protein (rbsC)
1435
53
periplasmic
D ribose ABC transporter, periplasmic binding protein
1436
88
cytoplasm
D ribose ABC transporter, periplasmic binding protein (rbsB)
-55-

WO 2005/111066

PCT/IB2005/001775

1438
246
inner 6
heme exporter protein C (ccmC) or cytochrome c type biogenesis protein
1439-
221
inner 6
heme exporter protein B (ccmB)
1440
212
cytoplasm
heme exporter ATP binding protein A (ccmA) or amino acid ABC transporter, ATP binding protein
1442
215
cytoplasm
superoxide dismutase (sodA)
1443
231
cytoplasm
ABC transporter, ATP binding protein
1445
105
cytoplasm
anti sigma factor B antagonist
,1446,-
99
cytoplasm
BolA/YrbA family protein
1447
424
inner 3
UDP N acetylglucosamine 1 carboxyvmyltransferase (murZ)
1448'
110
inner 1
amino acid ABC transporter, periplasmic binding protein
1449
135
cytoplasm
amino acid ABC transporter, periplasmic binding protein
1450
234
inner 3
amino acid ABC transporter permease protein
1458
51
cytoplasm
ATP-dependent Clp protease ATPase subunit (dpB)
1457
246
cytoplasm
RNA methyltransferase, TrmH family
1459
782
cytoplasm
virulence associated protein (vacB) or nbonuclease II family protein vacB
1460
83
cytoplasm
peptidyl prolyl cis trans isomerase, FkbP type (slyD) or FKBP type peptidyl pralyl cis trans isomerase
1462
128
cytoplasm
nbosome binding factor A (rbfA)
1463
306
cytoplasm
tRNA pseudoundme 55 synthase (truB)
1464
379
inner 1
chonsmate mutase / prephenate dehydrogenase (tyrA)
'1467
38
inner 1
chonsmate synthase (aroC)
1468
286
periplasmic
penicillin insensitive murein endopeptidase (mepA)
1472
318
inner 2
hpid A biosynthesis (kdo)2 (lauroyl) lipid IVA or HtrB/MsbB farpily protein
1473
126
inner 1
oligopeptide transporter, periplasmic binding protein,
1475
696
cytoplasm
oligopeptidase A (priC)
1476
292
cytoplasm
type 1 modification enzyme (hsdM)
1477
196
cytoplasm
type 1 modification enzyme (hsdM}
1480
204
cytoplasm
nboflavin synthase, alpha chain (nbE)
1 482
212
cytoplasm
aminopeptidase N (pepN)
1483
140
cytoplasm
glutaminyl tRNA synthetase (glnS)
1485
699
cytoplasm
4 alpha glucanotransferase (malQ)
1499
273
cytoplasm
glutamine synthetase (glnA)
1500
96
inner 1
glutamine synthetase (glnA)
1501
50
cytoplasm
glutamine synthetase (glnA)
1503
347
inner 0
DTDP-glucose 4 6 dehydratase (rffG)
15O5
527
cytoplasm
topoisomerase IV, subunit B (parE)
15O6
315
inner 1
ipid A biosynthesis lauroyl acyltransferase (htrB)
1507
308
cytoplasm
ADP heptose synthase (rfaE)
1508
83
cytoplasm
DNA directed RNA polymerase, beta chain (rpoC)
1509
829
cytoplasm
DNA directed RNA poiymerase beta chain (rpoC)
1510
332
inner 8
ellunte resistance protein (tehA)
1511
81
cytoplasm
ribosomal protein L13 (rpL13)
1512
153
cytoplasm
ribosomal protein S9 (rpS9)
1513
101
cytoplasm
urease, beta subunit (ureB)
1514
572
cytoplasm
urease alpha subunit (ureC)
-56-

WO 2005/111066

PCT/IB2005/001775

'15.15
185
inner 1
urease accessory protein (ureE)
1519
183
cytoplasm
urease accessory protein (ureF)
1520
107
cytoplasm
urease accessory protein (ureG)
1523
334
cytoplasm
ornithine carbamoyltransferase (arcB)
,1524,
310
cytoplasm
carbamate kinase (arcC)
1526
193
inner 3
efflux pump component MtrF mtrF
1527
113
inner 2
anaerobic C4-dicarboxylate membrane transporter protein
1528
136
inner 1
NADH dehydrogenase (ndh)
1530
315
cytoplasm
NADH dehydrogenase (ndh)
1531
410
inner 1
glyceroKS phosphate acyltransferase (plsB)
1532
367
inner 0
glycerol-3 phosphate acyltransferase (plsB)
1533
75
cytoplasm
exArepressor(lexA)
1534
121
cytoplasm
opacity protein or outer membrane protein NsgA nsgA
1537
227
Inner 4
argimne ABC transporter, permease protein (artM)
1538
221
inner 4
arginine ABC transporter, permease protein (artQ)
1539
72
cytoplasm
arginme ABC transporter, periplasmic binding protein (artl)
1541
99
penplasmlc
arginine ABC transporter, periplasmic binding protein
1542
243
cytoplasm
arginme ABC transporter, ATP binding protein (artP)
1544
69
cytoplasm
phosphoheptose isomerase (gmhA)
1545
73
cytoplasm
shikirnate 5 dehydrogenase-related protein
1546
267
cytoplasm
serine acetyltransferase (cysE)
1548
332
inner 1
glycerot 3-phosphate dehydrogenase (NAD+) (gpsA)
1549
567
cytoplasm
adenylate cyciase (cyaA)
1550
42
cytoplasm
adenylate cyciase {cyaA)
1551
228
cytoplasm
adenylate cyciase (cyaA)
1552
110
!ipo
ribosomal protein alanme acetyltransferase (nml)
1554
134
cytoplasm
DNA polymerase III, psi subunit (holD)
1556
222
cytoplasm
hemK protein hemK
1558
181
cytoplasm
GTP binding protein (era)
1559;
125
inner 0
GTP binding protein (era)
1561
227
cytoplasm
ribonuclease III (rnc)
1562
349
inner 3
signal peptidase I (iepB)
1565
345
cytoplasm
tail fibre protein
1568
395
cytoplasm
yrosyl tRNA synthetase (tyrS)
1569
315
inner 1
phosphonbosylpyrophosphate synthetase (prsA)
1575
72
inner 1
S1016V6 protein
1576
563
cytoplasm
glucose 6 phosphate isomerase (pgi)
-.1577
360
cytoplasm
alanine racemase, biosynthetic (air)
1578
126
cytoplasm
replicative DNA helicase (dnaB)
1579
303
cytoplasm
replicative DNA helicase (dnaB)
1582
991
outer hand
hemoglobin binding protein
1583
237
cytoplasm
zinc protease
1584.
276
inner 1
adenylosuccmate synthetase (purA)
1585
41
cytoplasm
adenylosuccinate synthetase (purA)
-57-

WO 2005/111066

PCT/IB2005/001775

1586
297
inner 1
2 3,4,5 tetrahydropyndine 2 carboxylate
1588
336
inner 1
punne nucleotide synthesis repressor (purR)
1589
78
cytoplasm
phosphoenolpyruvate carboxylase (ppc)
1590
45
inner 1
ribosomal protein S1 (rpS1)
1'59r
244
cytoplasm
cytidylate kinase 2 (cmkB)
1593
291
cytoplasm
singlet oxygen resistance protein
1597
549
inner 1
D lactate dehydrogenase (did)
1609,
462
inner 1
oxidoreductase
16J0
199
cytoplasm
spermidine/putrescme ABC transporter, perlplasmic-bmdlng
1633,
41
cytoplasm
carbonic anhydrase
1614
647
cytoplasm
ABC transporter, ATP binding protein
11318
289
inner 6
cytochrome C type biogenesis protein (ccmF)
1619
181
periplasmic
thiol disuifide interchange protein (dsbE)
1624"
152
cytoplasm
DNA ligase (lig)
1625
1027
inner 1
ype I restnction enzyme (hsdR)
1627
123
cytoplasm
anticodon nuclease prrC
1629
177
inner 1
oligopeptide ABC transporter ATP binding protein (oppD) orsulfate ABC ransporter ATP-binding protein cysA
1630
356
cytoplasm
oiigopeptide ABC transporter, ATP-binding protein (oppF) or sulfate ABC ransporter ATP-bmdmg protein cysA
1631
292
inner 1
membrane protein (lapB)
1635
683
cytoplasm
5 methyltetrahydropteroyltnglutamate hom*ocysteine
1636
73
cytoplasm
5 methyltetrahydropteroyltnglutamate hom*ocysteine
1639
363
cytoplasm
GTP binding protein
1640
194
cytoplasm
peptidyl tRNA hydrolase

1645
163
cytoplasm
exodeoxynbonuclease VII large subunit (xseA)
1646
183
cytoplasm
YhbX/YhjW/YijP/YjdB family protein
1648,
242
cytoplasm
leat shock protein (dnaJ)
1650
320
cytoplasm
heat shock protein 70 (dnaK)
1651
327
cytoplasm
heat shock protein 70 (dnaK)
1653
411
inner 8
gluconate permease gntP
1659
?69
cytoplasm
molybdenum cofactor biosynthesis protein A (moaA)
1662
337
inner 2
sugar isomerase, KpsF/GutQ family
1664
531
inner 1
single stranded-DNA specific exonuclease (recJ)
1665
39
cytoplasm
single stranded-DNA specific exonuclease (recJ)
,1666
235
outer
hiol disuifide interchange protein (dsbA)
16681
230
inner 1
pfe protein (pfs) or 5 methylthioadenosine
1670
565
cytoplasm
ransfernn binding protein orTonB dependent receptor
,1671
568
inner 1
on protease or ATP dependent protease La Ion
1672
139
cytoplasm
3 hydroxydecanoyl (acyl carrier-protein) dehydratase (fabA)
1678
1R5
cytoplasm
bactenofemtin comigratory protein (bcp)
1679
286
cytoplasm
dihydrodipicohnate synthetase (dapA)
1680
209
lipo
ipoprotein
1681
107
cytoplasm
sigma(54) modulation protein
1682
31?
cytoplasm
giycosyl transferase
-58-

WO 2005/111066

PCT/IB20 05/001775

1688
613
inner 2
sensor histidine kinase
1690
145
inner 1
UDP N-acetylglucosamme acetyltransferase (IpxA)
1692
403
inner 0
lipid A disacchande synthetase (IpxB)
"1693
197
inner 1
nbonucleaseHII(rnhB)
1694
146
cytoplasm
modification methyiase
1690
185
cytoplasm
nbosome releasing factor (rrf)
1698
226
inner 1
1 deoxy D xylulose 5 phosphate reductoisomerase {d> r)
1700i
171
cytopfasm
1-deoxy D xylulose 5 phosphate reductoisomerase (d>r)
,1704
370
cytoplasm
ribonucleoside dtphosphate reductase, alpha chain (nrcJA)
*1705
39
cytoplasm
ribonucleoside diphosphate reductase, beta chain {nrdB)
l706
311
cytoplasm
ribonucleoside diphosphate reductase, beta chain (nrdB)
1707,
409
inner 1
2 oxoglutarate dehydrogenase E2 component, dihydrolipoamtde
1708 ,
222
cytoplasm
2 oxoglutarate dehydrogenase E1 component (sucA)
1709
184
cytoplasm
ribosomal protein S4 (rpS4)
1712
314
inner 2
phosphosenne phosphatase (serB)
1714
680
cytoplasm
transketolase 1 (tklA)
1716
333
cytoplasm
biotin synthetase (bioB)
1717
217
cytoplasm
hiamin ABC transporter, ATP binding protein or spermidine/putrescine ABC transporter ATP binding
1718:
84
inner 1
hiamin ABC transporter, permease protein
1719
77
inner 1
molybdopetenn biosynthesis protein (mog)
1720
112
cytoplasm
nitrogen regulatory protein P II (glnB)
1722
348
inner 6
ransporter
1724
264
periplasmic
primosomal protein N1 (pnA)
1725
487
inner 1
primosomal protein N' (pnA)
1726
102
cytoplasm
PTS system glucose specific 1IA component (err)
1729
581
inner 1
phosphoenolpyruvate protein phosphotransferase (ptsl)
1730
92
cytoplasm
phosphocamer protein HPr (ptsH)
1733
189
cytoplasm
oligonbonuclease orn
1735
294
inner 2
phenylalanyl tRNA synthetase beta subunit (pheT)
1736
53
cytoplasm
ntegration host factor, alpha subunit {himA)
1738,
47
cytoplasm
ntegration host factor, alpha subunit (himA)
1739
161
lipo
ipoprotein (nlpC)
1747
87
cytoplasm
pyruvate kinase, type II (pykA)
1758
387
cytoplasm
modification methyiase NlalV
1766
90
cytoplasm
exodeoxynbonuclease, small subunit (xseB)
1767 ,
296
inner 1
geranyltranstransferase (ispA)
1768
316
cytoplasm
1-deoxyxylulose-5 phosphate synthase (dxs)
1770
99
inner 1
glycosyltransferase
1771
464
cytoplasm
fumarate hydratase class II (fumC)
1776
315
cytoplasm
dihydroorotate dehydrogenase (pyrD)
1780
669
cytoplasm
transferrin binding protein 2 precursor (tbp2)
1781
560
periplasmic
ransfernn binding protein 1 precursor (tbp1)
1782
152
inner 1
deoxyu rid inetn phosphatase (dut)
59-

WO 2005/111066

PCT/IB2005/001775

1783
400
inner 1
DNA/pantothenate metabolism flavoprotein (dfp)
1785
234
cytoplasm
DNA repair protein (radC)
1786
82
cytoplasm
ribosomal protein L28 (rpL28)
1787
56
cytoplasm
ribosomal protein L33 (rpL33)
1788
454
inner 1
L 2,4-diammobutyrate 2 ketoglutarate 4 ammotransferase or acetylomithtne aminotransferase argD
1790
132
cytoplasm
virulence associated protein C (vapC)
1791
443
cytoplasm
L 2,4 diaminobutyrate decarboxylase
1792
434
cytoplasm
ATP-dependent RNA helicase (hrpa)
1793
780
inner 1
ATP dependent RNA helicase (hrpa)
1794
122
cytoplasm
ATP dependent helicase (hrpa)
1799
243
Inner 5
cytochrome D ubiquinol oxidase, subunit II (cydB)
1800
198
cytoplasm
uxu operon regulator (uxuR)
1801
51
cytoplasm
mannonate dehydratase (uxuA)
, 18,02
33
cytoplasm
acyl earner protein (acpP)
1803
220
inner 5
anaerobic C4-dicarboxylate membrane transporter protein
1805
486
inner 5
NAD(P) transhydrogenase, subunit alpha (pntA)
1806
474
inner 7
NAD(P) transhydrogenase subunit beta (pntB)
1807
305
periplasmic
ranscnptional regulator
1808
70
cytoplasm
DNA topoisomerase I (topA)
1809
50
cytoplasm
signal recognrtion particle protein (ffh)
1812
88
cytoplasm
ype I restnction enzyme (hsdR)
1813
646
inner 1
type I restriction enzyme (hsdR)
1815
418
inner 1
type I restriction/modification specificity protein (hsdS)
1819
545
outer
heme hemopexm utilization protein B (hxuB)
1825
402
cytoplasm
xylose isomerase (xylA)
1826'
493
cytoplasm
xylulose kinase
I827
308
cytoplasm
ADP L glycero-D mannoheptose 6 epimerase (rfaD)
1828
167
inner 1
hioredoxin
1830
223
cytoplasm
deoxynbose phosphate aldolase (deoC)
1831
509
cytoplasm
competence protein (comM)
1834
7?
cytoplasm
glucose kinase
1835
288
inner 1
RpiR/YebK/YfhH family protein
1836
293
inner 0
N acetylneuraminate lyase (nanA) or dihydrodipicolinate synthase dapA
,1838
?70
cytoplasm
glucosamme 6-phosphate isomerase (nagB)
1839
381
cytoplasm
N acetylgiucosamme 6 phosphate deacetylase (nagA)
1840'
107
cytoplasm
outer membrane protein P2 (ompP2)
1841
38
cytoplasm
DNA polymerase III, delta1 subunit (holB)
1845
716
outer hand
LavA virulence protein
1846
237
cytoplasm
thymidylate kinase
1848
265
cytoplasm
arginmosuccmate synthetase (argG)
1855
97
cytoplasm
exonbonuclease li (rnb)
1858
188
cytoplasm
L lactate dehydrogenase (IctD)
1859
269
inner 1
glutamate racemase (murl)
-60-

WO 2005/111 066

PCT/IB2005/001775

1865"
I 893
cytoplasm
iATP-dependent DNA hetaase (recG)
1861
515
inner 1
guanosine 3' 5' bis(diphosphafe) 31 oyrophosphohydrofase
1867

69
cytoplasm
molybdenum ptenn binding protein {mopl}
1888
lua
cytoplasm
desutfovmdn gamma subunit ;
1870
393
inner 1
kimg protein {kscB)
1871
343
penplasrmc
enolase (eno)
1875
508
cytoplasm
catalase (hktE)
1876-
50
cytoplasm
glucosamine-fmctose 6 phosphate aminotransferase (glmS)
1877
232
cytoplasm
glycogen synthase (glgA)
1879
174
cytoplasm
glucose 1-phosphate adenylyltransferasg fglgC)
1880
283
cytoplasm
glucose 1 phosphate adenylyltransferase (glgC)
1881
435
inner 1
glycogen operon protein (glgX)
1882
229
inner 1
glycogen operon protein (glgX)
1883
685
cytoplasm
1,4-alpha glucan branching enzyme (gigB)
1884
119
cytoplasm
nbosoma! protein S10 (rpS10)
1885
315
inner 1
cys regulon transcriptional activator cysB
1886
217
cytoplasm
acetate CoA transferase alpha subunit
1887
233
cytoplasm
acetate CoA transfers beta subuntt (atoA)
1888
344
inner 5
short chain fatty acids transporter (atoE)
1889
84
inner 1
short chaiEi fatty acsds transporter (atoE)
1890
393
cytoplasm
acetyl CoA acetyltransferase (atoB)
1891
310
inner 4
ceil division protein (ftsX)
1892
119
periplasmic
cell division ATP binding protein (ftsE)
1893
129
cytoplasm
cell division ATP-binchng protein (flsE)
1894
175
cytoplasm
signal recognition particle docking protein FtsY (flsY)
1895
243
cytoplasm
peptide ABC transporter ATP binding protein (sapD)
1896
105
inner 2
peptide ABC transporter, permease protem (sapC)
1897
50
penplasmic
peptide ABC transporter, petmease protem (sapC)
1898
184
inner 4
peptide ABC transporter permease protein (sapC)
1899
321
inner 6
peptide ABC transporter, permease protein (sapB)
1900
584
outer
peptide ABC transporter, psnpiasmsc-bmding protem (sapA) ;
1903
72
cytoplasm
phosphoenolpymvate carboxylase (ppc)
1905
337
cytoplasm
oxidoreductase
1906
624
inner 1
oxidoreductase
1908
323
inner 0
fsrrochelatase (hemH)
1913
321
cytoplasm
thioredoxm reductase (trxS)

12?
cytoplasm
thtol peroxsdase (tpx) ,
I917
286
periplasmic
Dhosphoribosvffbrmvtfllvcmamidme synthase (purl)
1919
980
mner 1
priosphonbosylform^glycinamfdme synthase (purl)
1923
247
inner 0
tpool^osacchatide biosynthesis protein
1925
172
inner 5
qip protem
1928
235
cytoplasm
ribosomal large subunit pseudoundine gynthase D
1927
923
inner 1
ATP dependent helicase fhepA)
1928
249
cytoplasm
L fucose operon activator (fucR) or transcriptional regulator DeoR family
-61-

WO 2005/113066

PCT/IB2005/001775

1929
568
cytoplasm
ABC transporter ATP binding protein
1932
440
cytoplasm
hemoglobin binding protein

158
cytoplasm
hemoglobin binding protein
1934

140
cytoplasm
3,4 dihydroxy-2-butanone 4 phosphate synthase (nbB) or GTP cyclohydrolase
1935
282
inner 1
lipooligosacchande biosynthesis protein orlacto N neotetraose biosynthesis glycosyl
1936
160
cytoplasm
rRNA methylase
1938
355
cytoplasm
signal recognition particle docking protein FtsY (ftsY)
,1939
622
inner 9
O antigen acetylase
1940
380
cytoplasm
ribonuclease D (md)
11941
562
inner 2
long chain fatty acid coenzyme A ligase (fadD)
1942
183
lipo
outer membrane protein
11944
158
cytoplasm
ATP dependent helicase (dinG)
19494
357
cytoplasm
hemagglutmin/hemolysin related protein
1950
270
cytoplasm
traN related protein
1953
232
outer
outer membrane protein P2 (ompP2)
1954
366
cytoplasm
queuosme biosynthesis protein (queA) or S adenosylmethionine tRNA
1958
1392
outer
Adhesion and penetration protein
1959
504
cytoplasm
excinudease ABC, subunit A (uvrA)
1960
220
inner 1
excinudease ABC, subunit A (uvrA)
1962
384
outer
membrane bound lytic murein transglycosylase A
1963
261
inner 1
HesA/MoeB/ThiF family protein
1965
333
periplasmic
adhesin
1967
467
inner 1
NMB1183
1969
156
cytoplasm
ranscnptional regulator (ttk)
1971
224
cytoplasm
catabolite gene activator (crp)
1972
392
cytoplasm
RNA (uracil 5-) methyltransferase trmA
1973
351
cytoplasm
beta hexosamimdase (exoll) or glycosyl hydrolase, family 3
1975
299
cytoplasm
ong chain fatty acid transport protein (fadL) or outer membrane protein P1
1976
189
cytoplasm
methylated DNA-protem cysteme methyltransferase (dat1)
1977
87
cytoplasm
DNA mismatch repair protein (mutH)
1978
53
inner 0
DNA mismatch repair protein (mutH)
198O
71
cytoplasm
DNA mismatch repair protein {mutH)
1981
430
inner 1
cell cycle protein (mesJ)
1982
34
cytoplasm
pyndoxme kinase
1983
186
cytoplasm
acetyl CoA carboxylase carboxyl transferase subunit alpha
1984
141
cytoplasm
acetyl CoA carboxylase, carboxyl transferase subunit alpha
1986,
261
inner 9
membrane protein
1988
212
cytoplasm
ABC transporter ATP binding protein (yebM)
1989
127
cytoplasm
selenocysteine-specific elongation factor (selB)
1991
55
cytoplasm
selenocysteine specific elongation factor (selB) or translation elongation actor Tu tufA
1992
461
inner 1
L seryl tRNA selenium transferase (selA)
1993
861
inner 1
DNA mismatch repair protein (mutS)
-62-

WO 2005/111066

PCT/IB2005/001775

I995
74
inner 2
tryptophan specific transport protein (mtr)
1996
339
inner 5
tryptophan specific transport protein (mtr)
1997
81
mner 2
ATP synthase F0F subunlt a (atpB)
1998
88
inner 1
ATP synthase FO, subunit c {atpE}
1999
156
periplasmic
ATP synthase FO subunit b (atpF)
'2000
144
cytoplasm
ATP synthase F1, subunit delta (atpH)
2001
41
inner 0
ATP synthase F1, subunit delta

2002
513
cytoplasm
ATP synthase F1, subunit alpha (atpA)
2003
289
cytoplasm
ATP synthase F1, subunit gamma (atpG)
2005
76
inner 1
ATP synthase F1 subunit beta (atpD)
2007
372
cytoplasm
ATP synthase F1 subunit beta (atpD)
2008
147
inner 1
ATP synthase F1, subunit epsilon (atpC)
2009
54
inner 1
tyrosme specific transport protein (tyrP)
2010
117
inner 1
rlbosomal protein L20 (rpL20)
2011
77
cytoplasm
exodeoxynbonuclease V, beta chain (recB)
2012
1086
cytoplasm
exodeoxynbonuciease V, beta chain (recB)
2013
288
cytoplasm
exodeoxynbonuclease V, alpha chain (recD)
2014,
47
cytoplasm
exodeoxynbonuclease V, alpha chain (recD)
2016
194
cytoplasm
exodeoxynbonuclease V, alpha chain (recD)
202,1
107
cytoplasm
virulence associated protein A (vapA)
2022
556
cytoplasm
ABC transporter, ATP binding protein
"2028
435
cytoplasm
ranscnption repair coupling factor (mfd)
2029
228
cytoplasm
ranscnption repair coupling factor (mfd)
2030
392
cytoplasm
ranscnption repair coupling factor (mfd)
2031
36
cytoplasm
ranscnption repair coupling factor (mfd)
2032
86
cytoplasm
eucy! tRNA synthetase (leuS)
2034
688
cytoplasm
eucy! tRNA synthetase (leuS)
2036 2038
281
cytoplasm
undecaprenyl diphosphate synthase

288
inner 7
CDP diglycende synthetase (cdsA)
2041
283
inner 2
protective surface antigen D15 Omp85
2044-
256
cytoplasm
RNA polymerase sigma 70 factor (rpoD)
2045
300
cytoplasm
RNA polymerase sigma 70 factor (rpoD)
2046
347
cytoplasm
DNA primase (dnaG)
2047
191
cytoplasm
DNA primase (dnaG)
2048
52
cytoplasm
DNA primase (dnaG)
'2049
71
cytoplasm
ibosomal protein S21 (rpS21)
2050
342
inner 1
0 sialoglycopratem endopeptidase (gcp)
2051
206
cytoplasm
hymidinekmase(tdk)
2052
406
inner 10
tyrosine specific transport protein (tyrP) or Iryptophan transporter mtr
2053
86
cytoplasm
erredoxin 4Fe4S bacterial type (fdx 2)
2058
263
cytoplasm
phosphoglycerate kinase (pgk)
2059
81
cytoplasm
phosphoglycerate kinase (pgk)
2061
207
cytoplasm
amino acid ABC transporter ATP binding protein
2062
79
inner 0
amino acid ABC transporter, ATP binding protein
63-

WO 2005/111066

PCT/IB2005/001775

2065
230
inner 4
nbonuclease BN (rbn)
2066
53
cytoplasm
nbonuclease BN (rbn)
2070
273
Inner 1
undine phosphorylase (udp)
.2071
438
inner 9
transport protein
2073
568
inner 1
2 succmyl-6-hydroxy 2,4-cyclohexadiene 1 carboxylate
2074
185
cytoplasm
menaquinone specific isochonsmate synthase (menF) or anthramlate synthase component I trpE
2076
679
cytoplasm
excinuclease ABC, subunit B (uvrB)
.2079
756
inner 4
maiate oxidoreductase
2081
238
Inner 5
tyrosine specific transport protein (tyrP) ortryptophan transporter mtr
2083
228
inner 0
phosphonbosyl AMP cyclohydrolase / phosphonbosy! ATP
2084
258
cytoplasm
hisF cyclase (hisF)
2085
249
cytoplasm
phosphonbosylformimino 5 aminoimidazole carboxamide
2086
199
cytoplasm
amidotransferase (hisH)
2087
381
cytoplasm
imidazoleqlycerol phosphate dehydratase /
2088
367
cytoplasm
llstidmol phosphate ammotransferase (hisC)
2089
427
inner 1
ustidmol dehydrogenase (hisD)
2090
35
cytoplasm
ATP phosphonbosyltransferase (hisG)
-2091

199
inner 1
biotin operon repressor/biotln acetyl coenzyme A or BirA protein/Bvg accessory factor
2092
488
inner 1
nosine 5'-monophosphate dehydrogenase (guaB)
2094
523
Inner 1
GMP synthase (guaA)
2095
296
inner 7
rarD protein
2097
168
inner 0
ranscnptional regulator
2099
321
inner 10
Na+/H+ antiporter (nhaA)
2100
32
cytoplasm
lemolysin
2101
522
inner 7
apolipoprotein N-acyltransferase (cutE)
2106
193
cytoplasm
recombination associated protein RdgC rdgC
2108
105
cytoplasm
recombination associated protein RdgC rdgC
2110
290
cytoplasm
ntegrase/recombinase
2115
158
mner4
colicm V production protein (cvpA)
2118
441
inner 2
acetate klnase (ackA)
2119
331
periplasmic
phosphate acetyltransferase (pta)
2120
403
inner 1
phosphate acetyltransferase (pta)
2122
314
inner 1
adenine specific methylase
2123
323
cytoplasm
cys regulon transcription al activator (cysB)
2124
71
cytoplasm
phosphonbosylaminoimidazole carboxylase, catalytic subumt
2126
362
Inner 1
phosphoribosylammoimidazole carboxylase, ATPase subumt
2127
396
cytoplasm
aspartate ammotransferase (aspC)
2128
220
inner 1
spermidine/putrescine ABC transporter, ATP binding
2134
152
cytoplasm
mercuric resistance operon regulatory protein (merR2)
2138,
560
inner 10
PTS system fructose specific NBC component (fruA)
2139
313
cytoplasm
1-phosphofructokinase (fruK) or ADP heptose synthase
2140"
499
cytoplasm
PTS system, fructose-specific HA/FPr component (fruB)
2143
92
cytoplasm
virulence associated protein D (vapD)
-64-

WO 2005/311066

PCT/IB2005/001775

2146
101
inner 1
hypoxanthme phosphonbosyltransferase (hpt)
2147
451
cytoplasm
pmbA protein (pmbA)
2151
241
cytoplasm
ABC transporter, ATP binding protein
2152
164
cytoplasm
nitrogen regulatory HA protein (ptsN)
2155
202
cytoplasm
chonsmate mutase / prephenate dehydratase (pheA)
2157
148
cytoplasm
ABC transporter, ATP binding protein
2158
192
cytoplasm
histidmol phosphatase
'2160
221
cytoplasm
5,10 methylenetetrahydrofolate reductase (metF)
2161
89
cytoplasm
dethiobiotin synthase (bioD 1)
2162
313
inner 5
TRK system potassium uptake protein (trkH) or bis(5 -nucleosyl)-tetraphosphatase symmetncal/Trk
2163

191
inner 3
TRK system potassium uptake protein (trkH) or bls(5 nucleosyl)-tetraphosphatase symmetncal/Trk
2166
288
inner 4
heat shock protein (htpX)
2168
130
cytoplasm
nbonuclease
2169
244
inner 0
lipoprolem (vacJ)
2172
185
cytoplasm
transcription anbtermination protein (nusG)
2173
138
inner 3
preprotem translocase SecE subunit (secE)
2175
411
cytoplasm
ATP dependent Clp protease, ATP binding subunit (dpX)
2176
211
cytoplasm
ATP dependent Clp protease, proteolytic subunit (cIpP)
2177
394
cytoplasm
trigger factor (tig)
2178
52
cytoplasm
trigger factor (tig)
4180.
89
cytoplasm
ribosomal protein S20 (rpS20)
2181
524
inner 11
virulence factor (mviN)
2182
312
cytoplasm
riboflavin kinase / FMN adenylyltransferase (nbF)
2183
484
inner 1
isoleucyl tRNA synthetase ileS
2184
485
cytoplasm
isoleucyl tRNA synthetase IleS
2185,
102
cytoplasm
hit related protein
2186
184
cytoplasm
ipoprotein
2187
393
periplasmic
penicillin binding protein 5 (dacA)
2189
212
cytoplasm
lipoate biosynthesis protein B (lipB)
2190
320
cytoplasm
ipoate biosynthesis protein A (lipA)
2191
335
inner 1
citrate lyase ligase (cltC)
2192
95
cytoplasm
citrate lyase, gamma chain (citD)
2193
291
inner 0
citrate lyase beta chain (citE)
2195
500
inner 1
citrate lyase, alpha chain (citF)
2196
416
inner 1
citG protein (citG)
2200
256
inner 1
heme hemopexm utilization protein A (hxuA)
2202
458
cytoplasm
DNA repair protein (radA)
2204
166
inner 1
eucine responsive regulatory protein (!rp)
2205
554
inner 5
cell division protein FtsK ftsK-1
2208
169
cytoplasm
polypeptide deformylase (def)
2209
318
inner 1
methionyl tRNAfomiyltransferase (fmt)
2211
450
cytoplasm
sun protein (sun) or 16S RNA methyltransferase rsmB
,2212
458
cytoplasm
TRK system potassium uptake protein (trkA)
-65-

WO 2005/111066PCT/IB2O05/OO1775

2213
134
inner 2
large conductance mechanosensitive channel (mscL)
2Z15
40
cytoplasm
RNA polymerase sigma E factor (rpoE)
2231
347
inner 1
lipopolysaccharide biosynthesis protein orADP heptose LPS heptosyltransferase II rfaF
2232
539
outer
heme hemopexin utilization protein C or iron regulated outer membrane protein FrpB frpB
2233
170
cytoplasm
heme hemopexin utilization protein C
2234
565
outer
heme-hemopexin utilization protein B (hxuB)
2235
758
outer hand
heme hemopexin utilization protein A (hxuA)
2236
231
cytoplasm
DNA Iigase IigA 2
2238
327
cytoplasm
dipeptide ABC transporter ATP binding protein (dppF)
2241
330
cytoplasm
dipeptide ABC transporter, ATP binding protein (dppD)
2242
295
inner 6
dipeptide ABC transporter, permease protein (dppC) or thiol disulfide nterchange protein DsbD dsbD
.2243
333
inner 5
dipeptide ABC transporter permease protein (dppB)
2246
727
cytoplasm
DNA helicase II (uvrD)
2249
141
cytoplasm
6-pyruvoyl tetrahydrobioptenn synthase
2250
227
inner 0
aluminum resistance protein
2252,
184
cytoplasm
sranched-cham amino acid transaminase (ilvE)
2259
898
inner 1
exodeoxynbonuclease V, gamma chain (recC)
2260
163
cytoplasm
exodeoxynbonuclease V gamma chain (recC)
2262
372
inner 1
riboflavin biosynthesis protein (nbD)
2263
357
inner 1
protease (degS)
2274
192
inner 0
molybdopterin-guamne dmucleotide biosynthesis protein
2277
216
periplasmic
periplasmic oxidoreductase (por) or fhio! disulfide interchange protein DsbA dsbA2
2280
363
cytoplasm
RNA (uracil 5-) methyltransferase (trmA)
2282
125
inner 1
sigma E factor regulatory protein
'2283
33
cytoplasm
sigma-E factor regulatory protein
2285
178
inner 0
molybdoptenn guanine dmucleotide biosynthesis protein B
2289
652
cytoplasm
ATP dependent Clp protease, ATPase subunit (clpB)
2293
156
cytoplasm
DNA polymerase 1 (polA)
2294
785
cytoplasm
DNA polymerase 1 (polA)
2299
507
inner 0
N utilization substance protein A (nusA)
2301
855
cytoplasm
ranslation initiation factor 2 (infB)
2303
466
cytoplasm
type 1 restriction enzyme (hsdR)
2304
285
cytoplasm
ype 1 restriction enzyme (hsdR)
'2307
518
cytoplasm
anthranilate synthase component 1 (trpE)
2308
195
cytoplasm
anthranilate synthase component li (trpG) or para aminobenzoate synthase glutamine
'2311
84
cytoplasm
anthamlate phosphonbosyltransferase (trpD)
2313
231
cytoplasm
anthanilate phosphonbosyltransferase (trpD)
2314
477
cytoplasm
ndole 3 glycerol phosphate synthase /
2317
239
cytoplasm
valyl tRNA synthetase (valS)
2318
425
inner 1
valyHRNA synthetase

-66-

WO 2005/111066PCT/IB2005/001775

2319,
35
cytoplasm
valyl tRNA synthetase (valS)
2321
150
cytoplasm
valyl tRNA synthetase (valS)
2322
102
cytoplasm
valyl tRNA synthetase (valS)
2324
42
inner 1
transport protein
2325
238
cytoplasm
purme-nucleoside phosphorylase (deoD) or 5-methylthioadenosine
2327
142
inner 0
ribosomal protein L11 (rpL11)
2328
229
cytoplasm
ribosomal protein L1 (rpL1)
.2329
1298
cytoplasm
DNA directed RNA polymerase, beta chain (rpoB)
2331
158
cytoplasm
iron(lll) ABC transporter, periplasmic binding protein
2333
506
inner 11
iron(lll) ABC transporter permease protein (hltB)
2335
356
cytoplasm
iron(lll) ABC transporter, ATP binding protein (hitC)
2338
377
cytoplasm
succinyl-diammopimelate desucclnylase (dapE)
'2341
631
cytoplasm
heat shock protein (htpG)
2344,
106
periplasmic
organic solvent tolerance protein
2345
667
cytoplasm
organic solvent tolerance protein
2346,
572
inner 1
prolyl tRNA synthetase (proS)
2347
630
inner 1
ATP dependent DNA helicase (recQ)
2348
113
cytoplasm
cyaY protein (cyaY)
2350
415
cytoplasm
diaminopimelate decarboxylase (lysA)
2351

208
cytoplasm
nitrate/nitrite response regulator protein (narP) or tranacnptional regulator, LuxR family
2354

203
cytoplasm
pseudourldine synthase RluD (rluD) or ribosomal large subunit )seudoundme synthase D
2356
272
lipo
ipoprotein or competence Iipoprotefn ComL comL
2359
246
cytoplasm
pyruvate formate lyase activating enzyme (act)
2360
772
cytoplasm
ormate acetyltransferase (pfl)
'2361
286
inner 6
formate transporter
2365
276
inner 2
sugar kinase
2368
377
inner 5
amino acid carrier protein
2371
158
inner 0
YgbBA'acN family protein
2373
146
cytoplasm
mioC protein (mioC) orsulfite reductase (NADPH) flavoprotein, alpha
2376
333
inner 1
glpX protein (glpX)
2381
551
inner 6
ABC transporter, ATP binding protein
2382'
360
inner 2
ATP binding transport protein (cydD)
2383
228
cytoplasm
heat shock protein (grpE)
2385
520
cytoplasm
DNA repair protein (recN)
2387
38
cytoplasm
DNA repair protein (recN)
2388
981
Inner 1
glutamate ammonia ligase adenylyltransferase (glnE)
2339
311
cytoplasm
RNA delta(2) isopentenylpyrophosphate transferase (trpX)
2390
390
cytoplasm
DNA mismatch repair protein (mutL)
2391
123
cytoplasm
hymidylate synthetase (thyA)
2392
173
cytoplasm
cytidine and deoxycybdylate deaminase family
2395
545
cytoplasm
preprotem translocase SecA subunit (secA)
2396
363
cytoplasm
preprotein translocase SecA subunit (secA)
,2397
163
cytoplasm
mutator mutT protein {mutT)
-67-

WO 2005/111066

PCT/IB2005/001775

2398
618
inner 10
glutathione regulated potassium efflux system protein (kefC)
2399
254
cytoplasm
3-demethylubiqumone 9 3 methyltransferase ubiG
2401
245
cytoplasm
ribosomal protein S2 (rpS2)
2402
71
inner 1
preprotem translocase SecY subunit (secY)
2403
144
cytoplasm
ribosomal protein L15 (rpL15)
2404
59
cytoplasm
ribosomal protein L30 (rpL30)
2405
267
inner 1
glucosamme- fructose-6-phosphate aminotransferase (glmS)
2406
177
inner 3
disulfide bond formation protein B (dsbB)
2407
238
Inner 5
Na+/H+ antiporter (nhaB)
2408
292
inner 5
Na+/H+antiporter(nhaB)
2410
241
cytoplasm
fatty acid metabolism regulator protein (fadR)
2411
455
cytoplasm
phosphatidylsenne synthase (pssA) or cardiolipin synthetase family protein
'2412
201
cytoplasm
rRNA methylase
2413,
232
cytoplasm
adenme specific methylase
2415
122
cytoplasm
ATP dependent RNA helicase SrmB (srmB)
2416
287
cytoplasm
ATP dependent RNA heiicase SrmB (srmB)
2417
231
cytoplasm
protease
2418
203
cytoplasm
ATP ph os phonbosyltransferase (hisG)
2421
410
cytoplasm
D 3 phosphoglycerate dehydrogenase (serA)
,2422
219
inner 1
ribose 5 phosphate isomerase A (rpiA)
2423
383
cytoplasm
oxygen-independent coproporphyrmogen III oxidase
2424
658
cytoplasm
ATP dependent protemase (Ion)
2428
298
cytoplasm
ranscnptionai regulator, araC family
2429
38
cytoplasm
ABC transporter, ATP-binding protein
2430
576
inner 4
ABC transporter, ATP-binding protein
2432
92
periplasmic
mercuric ion scavenger protein (merP)
2433
120
inner 3
mercuric ion transport protein (merT)
2435
472
cytoplasm
anaerobic dimethyl sulfoxide reductase, chain A (dmsA)
2436
352
cytoplasm
anaerobic dimethyl sulfoxide reductase chain A (dmsA)
2437
205
cytoplasm
anaerobic dimethyl sulfoxide reductase chain B (dmsB)
2438
279
inner 7
anaerobic dimethyl sulfoxide reductase chain C (dmsC)
2440
166
cytoplasm
ferredoxin type protein (napF) or NADH dehydrogenase I, I subunit nuol
2443
133
cytoplasm
2 isopropylmalate synthase (leuA)
2445
358
cytoplasm
3 isopropylmalate dehydrogenase (beta IPM dehydrogenase)
2446
469
cytoplasm
3-isopropylmalate dehydratase, alpha subunit (leuC)
2447
200
inner 0
3 isopropylmalate dehydratase small subunit (leuD)
2448
1794
outer hand
mmunoglobin A1 protease (iga1) or IgA specific serine endopeptidase iga
2449
378
cytoplasm
DNA/ATP binding protein (recF)
2450
366
cytoplasm
DNA polymerase III, beta subunit (dnaN)
2452
454
cytoplasm
chromosomal replication initiator protein (dnaA)
2453
118
cytoplasm
ransfernn binding protein 1 precursor (tbp1)
2454
231
cytoplasm
transfernn binding protein 1 precursor (tbp1)
'2457
199
inner 1
baseplate assembly protein V
2462
861
cytoplasm
ail fibre protein
-68-

WO 200S/111066

PCT/BB2005/O01775

2476
89
cytoplasm
aspartokinase I /hom*osenne dehydragenase! (thrA)
2477
307
cytoplasm
aspartoklnase I /hom*osenne dehydrogenase I (thrA)
2478
314
inner 1
hom*osenne kinase (thrB)
2479
425
cytoplasm
threonine synthase (thrC)
2480
238
cytoplasm
mtegrase/recombinase (xerC)
2491
178
cytoplasm
ferrsdoxin type 4Fe4S protein JnapF)
2492
93
cytoplasm
napD protein (napD)
2493
832
outer hand
Formate dehydrogenase major subumt
2494
279
cytoplasm
ferredoxm type protein (napG)
2495
287
inner 4
feriBdoxin type 4Fe 4S protein (napH)
2496
150
periplasmic
periplasmic nitrate reductase (napB)
2497
J2QQ
inner 1
cytochrome C-type protein (napC)
2498
214
inner 0 '
adenylate Nmase (adk)
2499
412
inner 10
permease or AmpG related protein
2501
241
inner 0
UDP glucose 4-epimerase (galE)
2502
82
cytoplasm
UDP giucose 4-epimerase (gaE)
2504
244
cytoplasm
ron(lll) ABC transporter, ATP binding protein fbpc
2505
176
inner 4
ABC transporter, permease protein
2508

241
periplasmic
FkbP type pepbdyl proly! cis trans isomerase (fkpA) or mao-ophage
nfectiVity potentiator
2509
73
cytoplasm
slyX protein (slyX)
2511
33
cytoplasm
peroxiredoxin 2 family protein/glutaredoxin
2512
48
cytoplasm
peroxtredoxtn 2 family proteln/glutaredoxsn ]
2513
117
cytoplasm
peroxiredoxin 2 family protem/glutaredoxin
2514
301
cytoplasm
hydrogen peroxide inducible genes activator (oxyR) or transcnptionai egulaior, LysR family
2517
158
cytoplasm
ranscrsption elongation factor fgreB) !
2518
770
cytoplasm
ranscnption accessory protein (tex) l
2519
736
cytoplasm
DNAqyrase subunit B (gyrB)
2520
59
cytoplasm
DNAqvrase subunit B (gyrB)
2521
234
cytoplasm
ibulose phosphate 3 epimerase (dod) I
2522
224
cytoplasm
phosphoglycolate phosphatase (gph)
2530
132
cytoplasm
ransposase
2531

369
inner 8
multidrug resistance protein B (emrB) or fatty acid eiflux system protein
arB _
r2532
256
Inner 1
cell division protein (ftsN)
2533
1032
inner 12
acnftavine resistance protein (acrB) or multiple transfstdble resistance system protein MtrD
2534
419
inner 1
ipoprotein or membrane fusion protein mtrC
2535
196
cytoplasm
ranscnptional represser (Bm3R1) or trancscnptional regulator MtrR mtrR
2538
418
cytoplasm
ATP dependent RNA heiscase (rhlB)
2541
210
periplasmic
kinase
2542
421
inner 1
serine hydroxymethyltransferase (serine methylase} (glyA)
2543

inner 3
YhbX/YhsW/YijP/Y]dB family protein
2544
85
cytoplasm
phosphonbosylamme-giyctne ligase (purD)

WO 2005/113066

PCT/1B2005/001775

2543

101

inner 1 jcelf division protein (ftsQ)

306
475
351
394
437
cytoplasm
380
45? ' cytoplasm
610
inner 1
107
208
cytoplasm
2548'
2548
2550
'2552
2553
2554
2555
2558'
2557
2558
2561

jnner 0 p afanme-P afansne ligase (ddlB)
inner 2 UDP-N acetyimuramate-alanma ligase (murC)
inner 1
UOP-N aceiyig!ucQsamine-N acetyimuramyi (pentapeptide)
Inner 9
cell division protein fftsWj
UDP N acetylmuramoylalanme-D glutamate ligase (murD)
inner 10
phospho N acetylmuramoyi-penlapsptide transferass E (mraY)
UDP MwWAc pentapepfade synihetase (murB
inner 1
UDP N acetyimuramyi tnpepistie synthetase fmurE}
pemciiim binding protein 3 (flsl)
inner 1
cell division protein (ftsL)
fticulokmase (f*ck)

2584
25691

269

cytoplasm
inner 0

transcnpiionaS regulatory protein (asnC)
ulfite synthesis pathway protein (cysQ) or inos(to) monophosphatass famsiy protem

2570^
2571
2577
2578

474
245
392
78

inner 0
cytoplasm
Inner 1
mner 0

glucose-6 phosphate 1-dehydrogenase {zwf)
oxidoreductase (devB)
6 phosphogluconate dehydrogenase decarboxylating (gnd)
8 phosphogluconats dehydrogenase, daearboxyiatsng (gnd)

2581

312

cytoplasm
cytoplasm

diadenosine tetraphosphatase (apaH) or bss{5 -nucleosyi; ietraphosphatase, symmetnca!/Trk
iipooiigosacchande biosynthesis protein or lacto N neotetraose biosynthesis giycosyl

287

cytoplasm

dimethyladenosme transferase (ksgA)

2584.

253

cytoplasm

popolysacchande glycosyl iransferase

2585'-

cytoplasm

lipopoiysacchande gtycosyi transferase

cytoplasm

ranslation initiation factor 1 {infA)

2587
-25B8

364

Inner 8
lipo

giycerol-3-phosphatase transporter (gipT}_
glycerophosphoryl diesterphosphodiesterase (glpQ)

2591 217

inner 4

glycerol uptake facilitator protein (gtpF)

2592 ! 503

cytoplasm

glycerol klnase k

2593
2594 2595
,2597
-2598

155
45
274
132
212

inner 1
cytoplasm
lipo
inner 1
cytoplasm

xanlhine guamne phosphoribosyltransferase (gptE
fllycerophosphoryi Chester phosphodiesterase (gipQj
llpoproiein E (hel)
exopolyphosphatase
exopolyphosphatase

133

inner 1

;ide chain release factor 3 (prfC)

2600
2610

cytoplasm
pertplasmic

transcnptlonal activator (metR)
pyrrohne 5 carfaoxylate reductase (proC)

2612

mner 0

pyrrolme 5 carfaoxylate reductase (proC)

2617

297

cytoplasm

mtegrase/recombmase (xerD)

2619 335

cytoplasm

Hoiliday junction DNA helicase (ruvB)

2620 204
2621 190

cytoplasm
Hoiliday junction DNA helK^se (ruvA)
cytoplasm (crossover junction sndodeoxynbonuclease (ruvG)

2625 156

cytoplasm |datP pyrophosphohydroiase (ntpA)
-70-

WO 2005/11106(5

PCT/IB2005/001775

2525
588
cytoplasm
aspartyl tRNA synthetase (aspS)
2629
78
cytoplasm
virulence associated protein B (vapB)
2630
134
cytoplasm
virulence associated protein C
'2631
135
cytoplasm
lactoylglutathione lyase (gloA)
2632
229
cytoplasm
nbonuclease T (rnt)
2636
188
cytoplasm
translation elongation factor P (efp)
2640
431
inner 1
opacity associated protein (oapA)
2641
134
lipo
opacity associated protein (oapB)
2642
236
cytoplasm
DNA repair protein (recO)
2643
438
cytoplasm
tRNA (uracil 5) meihyltransferase frmA
2644
651
cytoplasm
elongation factor G (fusA)
2646
394
cytoplasm
elongation factor Tu (tufB)
2647
75
inner 2
chloride channel protein related protein
2649
245
inner 3
chloride channel protein related protein
2654
336
cytoplasm
Iryptophany! tRNA synthetase (trpS)
2657 ,
92
cytoplasm
adenylosuccinate lyase (purB)
2659
364
cytoplasm
adenylosuccinate lyase (purB)
' 2660
163
cytoplasm
ribosomal protein L10 (rpL10)
2661
126
inner 0
ribosomal protein L7/L12 (rpL7/L12)
2663
456
inner 0
UDP N acetylglucosamine pyrophosphorylase (glmU)
2665
311
cytoplasm
ysophospholipase L2 (pldB)
2666
371
cytoplasm
aspartate semialdehyde dehydrogenase (asd)
2667
243
inner 4
ransport protein
2670
136
cytoplasm
modulator of drug activity B (mdaB)
2671
42
cytoplasm
modulator of drug activity B (mdaB)
2672
676
cytoplasm
ATP dependent DNA helicase (rep)
2674
156
inner 1
ipopolysacchande core biosynthesis protein (kdtB)
2675
427
inner 2
3 deoxy d manno octulosomc acid transferase (kdtA)
2676
254
cytoplasm
ipopolysacchande biosynthesis protein or beta 1 4 glucosyltransferase IgtF
26781
192
cytoplasm
DNA 3 rnethyladenme glycosidase I (tagl)
2680
268
inner 1
shikimate 5 dehydrogenase (aroE)
2682
178
cytoplasm
DNA topoisomerase I topA
2683
63
cytoplasm
ABC transporter ATP binding protein
2685,
115
cytoplasm
anaerobic ribonucleoside triphosphate reductase (nrdD)
2686
272
cytoplasm
anaerobic ribonucleoside-triphosphate reductase (nrdD)
2687
286
cytoplasm
acyl CoAthioesterase II (tesB)
2688
469
cytoplasm
cysteinyl tRNA synthetase (cysS)
2689
169
cytoplasm
peptidyl prolyl cis trans isomerase B (ppiB)
"2698
107
cytoplasm
hioredoxin (trxM)
2701
335
inner 1
D lactate dehydrogenase, fermentative (IdhA)
2702
393
inner 1
cystathionme gamma synthase (metB)
2703,
175
inner 1
ParA family protein
2705
451
periplasmic
repiicative DNA helicase (dnaB)
2714
140
cytoplasm
single stranded DNA binding protein (ssb)
71-

WO 2005/111066

PCT/IB2005/001775

,2717
686
cytoplasm
DNA topoisomerase IIl (topB)
2722
156
cytoplasm
DNA repair protein (radC)
2733
150
cytoplasm
mutT protein mutT
2735
170
inner 3
transport protein
2736
280
cytoplasm
aspartate ammonia lyase (aspA)
2736-
236
periplasmic
aspartokinase I / hom*osenne dehydrogenase I (thrA)
2739,
317
cytoplasm
transaldolase B (talB)
2740
217
inner 1
glyceraldehyde 3 phosphate dehydrogenase (gapdH)
2741
34
cytoplasm
nner membrane protein, 60 kDa (yidC)
2742
204
cytoplasm
nner membrane protein 60kDa(yidC)
2745
229
cytoplasm
sufl protein (sufl)
2747
167
cytoplasm
heat shock protein (hsIU) or ATP dependent Clp protease, ATP binding subunit
2748
94
cytoplasm
spermidine/putrescme ABC transporter periplasmic binding
.2749.
287
inner 8
drug resistance translocase family protein

2750

325
inner 2
potassium/copper transporting ATPase or cation transport ATPase, E1 E2 family
2751
349
cytoplasm
2 oxoglutarate dehydrogenase E1 component (sucA)
'27512
34
cytoplasm
2 oxoglutarate dehydrogGnase E1 component (sucA)
2755
38
inner 1
serine transporter (sdaC)
2756
217
inner 4
serine transporter (sdaC)
2758;
75
lipo
hermonuclease family protein
2761
144
cytoplasm
orfG protein
2762
51
cytoplasm
methionine ammopeptidase {map}
2763.
343
cytoplasm
protein Pll undyiyltransferase glnD
2764
107
inner 4
ransporter
2765
282
inner 5
protein export membrane protein (secF)
2766
96
cytoplasm
recA protein (recA)
2768
152
cytoplasm
regulatory protein (recX)
2769
111
lipo
crcB protein
2772
163
cytoplasm
ranscnptional regulatory protein (tyrR) or nitrogen assimilation regulatory protein NtrX ntrX
2774
209
inner 1
glutathione transferase (bphH) or stringent starvation protein A sspA
2780
43
cytoplasm
CTP synthetase (pyrG)
2782
138
cytoplasm
CTP synthetase {pyrG)
- 2785
167
cytoplasm
ranscnptional regulator
2786
93
cytoplasm
guanylate kinase (gmk)
-2788
88
cytoplasm
DNA directed RNA polymerase, omega chain (rpoZ)
2789
84
cytoplasm
guanosine 3',5-bis{diphosphate) 3- pyrophosphohydrolase
2790
38
cytoplasm
guanosine-3151 bis(diphosphate) 3' pyrophosphohydrolase
2792
90
cytoplasm
S adenosylmethionme 2-demethylmenaqumone methyltransferase
2795
120
cytoplasm
bs repressor (rbsR)
2801
113
cytoplasm
ferredoxin {fdx 1) or ferredoxm 2Fe 2S type fdx 2
2807
266
inner 1
modification methylase (hind HIM)
'2811
350
cytoplasm
asparaginyl tRNA synthetase (asnS) or aspartyl tRNA synthetase asps
-72-

WO 2005/111066

PCT/IB2005/001775

2312
31
cytoplasm
nbofiavm synthase beta chain (nbH)

228
Inner 3
PqlA family protein
2814
282
inner 1
pqiB protein pqiB

112
cytoplasm
asparaginyl tRNA synthetase (asnS) or aspartyl-tRNA synthetase aspS
2817
128
cytoplasm
carbonic anhydrase
2818
122
cytoplasm
transcriptional regulatory protein (tyrR)
2825
215
cytoplasm
pqiB protein pqiB
2827.
194
cytoplasm
phosphoheptose isomerase gmhA
2831
233
cytoplasm
28 kDa outer membrane protein (hlpA)
2832
33
cytoplasm
glycerol 3 phosphate regulon repressor (glpR)
REFERENCES (the contents of which are hereby incorporated by reference)
[I]Fleischmann etal (1995) Science 269 496-512
[2] L\et al (2003) Mol Microbiol 47 1101 1111
[3] GenBank accession NC_000907
[4] Geysen et al (1984) PNAS USA 81 3998 4002
[5] Carter (1994) Methods Mol Biol 36 207-23
[6] Jameson,BAetal L988, CABJOS4(1) 181-186
[7] Raddnzzam & Hammer (2000) Brief Bwmfoim 1(2) 179 89
[8] DeLallaefa/ (1999) J Immunol 163 1725 29
[9]Brusicera/ (1998) Bwmformatws 14(2) 121 30
[10] Meisteref al (1995) Vaccine 13(6) 581-91
[11]Roberts et al (1996) AIDS Res Hum Reti ovn uses 12(7) 593-610
[12] Maksyutov & Zagrebelnaya (1993) ComputAppl Biosa 9(3) 291-7
[13] Feller & de la Cruz (1991) Nature 349(6311) 720-1
[14] Hopp (1993) Peptide Research 6 183-190
[I5]Welling et al (1985)FEBS Lett 188215-218
[16] Davenport et al (1995) Immunogenetics 42 392-297
[17] Bodanszky (1993) Pi maples of Peptide Synthesis (ISBN 0387564314)
[18] Fields et al (1997) MethEnzymol 289 Solid-Phase Peptide Synthesis ISBN 0121821900
[19] Chan & White (2000) Fmoc Solid Phase Peptide Synthesis ISBN 0199637245
[20] Kullmann (1987) Enzymatic Peptide Synthesis ISBN 0849368413
[21] Ibba (1996) Biotechnol Genet Eng Rev 13 197-216
[22] Breedveld (2000) Lancet 355(9205) 735 740
[23] Gorman &. Clark (1990) Semin Immunol 2 457-466
[24] Sambrooke et al (1989) Molecular Cloning A Labotatory Manual
[25] Short protocols in molecular biology (4th ed, 1999) Ausubel etal eds ISBN0-471-32938-X
[26] US patent 5 707,829
[27] Current Protocols in Molecular Biology (F M Ausubel et al eds 1987) Supplement 30
[28] EP-B 0509612
-73-

WO 2005/111066PCT/IB2005/001775
[29] EP-B-0505012
[30] Yadav et al (2003) LettAppl Microbiol37(3) 190-5
[31] Smghi etal (2002) Ann Trop Paediatr 22(4) 347-53
[32] Tang etal (1997) Clin Chem 43 2021-2038
[33] Vaccine Design (1995) eds Powell & Newman ISBN 030644867X Plenum
[34]WO00/23105
[35] WO90/14837
[36] US patent 5,057,540
[37] WO96/33739
[38] EP-A-0109942
[39] WO96/11711
[40] WO00/07621
[41] Barr et al (1998) Advanced Drug Delivery Reviews 32 247-271
[42] Sjolandera/ (199$) Advanced Drug Delivery Reviews 32 321-338
[43] Nukura et al (2002) Vinology 293 273-280
[44] Lenz et al (2001) J'Immunol 166 5346 5355
[45] Pinto et al (2003) JInfectDis 188 327-338
[46] Gerber et al (2001) Vnol 15 4752 4760
[47] WO03/024480
[48] WO03/024481
[49] Gluck et al (2002) Vaccine 20 B10-B16
[50] CP-A-0689454
[51] Johnson et al (1999) BiooigMed Chem Lett 9 2273-2278
[52] Dyans et al (2003) Dcpei t Rev Vaccines2219-229
[53] Meraldi etal (2003) Vaccme 21 2485-2491
[54] Pajak et al (2003) Vaccme 21 836-842
[55] KanchmallaeM/ (2003) Nucleic Acids Resea? ch 31 2393-2400
[56] WO02/26757
[57] WO99/62923
[58] Krieg (2003) Nature Medicine 9 831-835
[59]McClushe et al (2002) FEMS Immunology and Medical Microbiology 32 179-185
[60] WO98/40100
[61] US patent 6,207,646
[62] US patent 6 239,116
[63] US patent 6,429,199
[64] Kandimilla et al (2003) Biochemical Society Transactions 31 (part 3) 654-658
[65] Blackwell et al (2003) J Immunol 170 4061-4068
[66] Kneg (2002) Trends Immunol 23 64-65
[67] WO01/95935
[68] Kandimalla et al (2003) SBRC 306 948-953
[69] Bhagat et al (2003) BBRC 300 853-861
-74-

WO 2005/111066PCT/IB2005/001775
[70]WO03/035836
[71]WO95/17211
[72] WO98/42375
[73] Beignon et al (2002) Infect Immun 70 3012-3019
[74] Pizza et al (2001) Vaccine 19 2534-2541
[75] Pizza et al (2000) Int J Med Microbwl 290 455-461
[76] Scharton-Kersten etal (2000) Inject Immun 68 5306-5313
[77] Ryan et al (1999) Infect Immun 67 6270-6280
[78] Partidos et al (1999) Immunol Lett 61209-216
[79] Peppolom et al (2003) Expert Rev Vaccines 2 285-293
[80] Pine et al (2002) J Control Release 85 263-270
[81]Domemghini et al (1995) Mot Microbwl 15 1165-1167
[82] WO99/40936
[83]WO99/44636
[84] Singh et al] (2001) JCont Release 70 267 276
[85] WO99/27960
[86] US patent 6 090 406
[87] US patent 5 916 588
[88]EP-A-0626169
[89] WO99/52549
[90] WO01/21207
[91] WO0I/2U52
[92] Andnanov et al (1998) Bwmatenals 19 I09-U5
[93] Payne el al(1998) Adv Drug Dcltvety Review 31 185-196
[94] Stanley (2002) Clin Exp Dermatol 27 571-577
[95] Jones (2003) Curr Opin Investig Drugs 4 214-218
[961WO99/11241
[97]WO94/00153
[98] WO98/57659
[99] European patent applications 0835318, 0735898 and 0761231
[100]WO03/009869
[101] Almeida &AIpar (1996) J DrugTargeting3 455-467
[102] Agarwal &Mishra(1999)Indian JExpBxolZl 6-16
[103]Costantino et al (1992) Vaccine 10 691-698
[104] Costantino etal (1999) Vaccine 17 1251 1263
[105]WO03/007985
[106] Watson (2000) Pediatr Infect DtsJ\9 331-332
[107] Rubin (2000) PediaU Clm North Am 47 269-285, v
[108] Jedrzejas (2001) Mia obwl Mol Bml Rev 65 187-207
[109] Bell (2000)Pediati Infect DisJ19 1187 1188
[110] Iwarson (1995) APMIS 103 321-326
-75-

WO 2005/111066PCT/IB2005/001775
[111] Gerhch et al (1990) Vaccine 8 Suppl S63-68 &79-80
[112] Vaccines (1988) eds Plotkin & Mortimer ISBN 0-7216-1946-0
[113] Del Guidice etal (1998) Molecular Aspects of Medicine 19 1-70
[114] Gustafsson etal (1996)N Engl J Med. 334 349-355
[115] Rappuoh etal (1991) TIBTECH9 232-238
[116] Sutler et al (2000) Pediati CtmNorthAm 47 287-308
[117] Zimmerman & Spam (1999) Am Fam Physician 59 113-118, 125-126
[118] McMichael (2000) vaccine 19 Suppl 1 S101-107
[119] Schuchat (1999) Lancet 353(9146) 51-6
[120] WO02/34771
[121] Dale (1999) Infect Dis Clin North Am 13 227-43, V111
[122] Ferretti et al (2001)PNAS USA 98 4658-4663
[123]Kuroda et al (2001) Lancet 357(9264) 1225-1240, see also pages 1218-1219
[124] EP-A-0372501
[125]EP-A-0378881
[126] EP-A-0427347
[127]WO93/17712
[128] WO94/03208
[129] WO98/58668
[130] EP-A 0471177
[131] WOOO/56360
[132]WO91/01146
[133] WO00/61761
[134]WO01/72337
[135] Resea) ch Disclosure, 453077 (Jan 2002)
[I36]Needleman&Wunsch(1970)/Mol Biol 48,443-453
[ 137] Rice et al (2000) Ti ends Genet 16 276-277
[138] Gennaro (2000) Remington The Science and Practice of Pharmacy 20th edition, ISBN 0683306472
[139] Methods In Enzymology (S ColowickandN Kaplan, eds Academic Press Inc)
[140] Handbook of Experimental Immunology Vols I-IV (DM Weir and CC Blackwell, eds,
19S6, Blackwell Scientific Publications)
[141] Sambrook, et al, Molecular Cloning A Laboratory Manual (2nd Edition, 1989)
[142] Handbook of Surface and Colloidal Chemistry (Budi, K S ed , CRC Press, 1997)
[143] Short Protocols in Moleculai Biology 4th ed (Ausubel et al eds, 1999, John Wiley & Sons)
[144] Molecular Biology Techniques An Intensive Laboratory Course (Ream et al, eds, 1998,
Academic Press)
[H5]PCR(Introduction to BiotechniquesSeries) 2nded (Newton & Graham eds 1997 Springer Verlag)
[146] Mason etal (2003)Infect Immun 11 3454-3462
[I47]Drdile etal (1993) Infect Immun 61 81-90
76

WO 2005/111066
PCT/IB2005/001775
CLAIMS
1 A polypeptide comprising an amino acid sequence that has at least 75% sequence identify to one or more of SEQ ID
NOS 1566,5095,1570,5094,1574,5903,1578,5092,2,4,6,8,10,12,14,16,18,20,22,24,26,28,30,32,34,36,38?
40,42,44,46 48,50,52,54,56,58,60,62,64,66,6S, 70,72,74 76,78, 80, 82,84,86 88 90 92,94,96,98, 100 102,
104,106, 108,110,112,114,116, 118, 120,122,124,126,128,130,132,134,136,138,140,142,144,146,148 150,
152,154,156,158,160,162,164 166 168,170,172,174,176,178,180,182,184,186,188,190,192,194,196,198, 200 202 204 206,208,210,212,214,216,218 220,222,224,226,228, 230,232,234,236,238,240,242,244,246, 248,250,252 254 256,258 260,262,264,266,268,270,272,274,276,278,280 2S2 284,286,2S8,290,292,294, 296,298,300, 302,304,306,308,310,312,314,316,318,320,322,324, 326 328,330,332,334,336,338, 340 342
344,346,348,350,352,354 356 358 360,362,364 366,368,370,372,374,376,378,380,382,384,386,388,39Os
392,394,396,398,400,402 404,406,408,410 412,414,416,418,420 422,424,426,428,430,432,434,436 438 440,442,444,446,448,450,452,454,456,458,460,462,464,466,468 470 472,474,476,478,480,482,484,486, 488,490,492,494,496,498,500, 502,504,506,508,510,512,514,516, 518,520,522 524, 526, 528, 530, 532, 534, 536 538 540 542 544,546 548,550,552,554,556 558,560 562,564,566 568,570 572, 574 576 578, 580 582
584,586, 588, 590,592,594, 596,598,600,602,604,606, 60S, 610,612, 614,616,618,620,622,624 61$ 628,630
632,634,636, 638,640,642, 644,646,648,650,652,654, 656 658, 660, 662,664,666,668,670,672 674 676, 678 680,682,684,686,688,690,692 694 696,698 700,702,704 706,708 710 712,714,716 718,720 722,724 726, 728,730,732,734,736,738,740,742,744,746,748,750,752,754,756,758,760,762,764,766,768,770,772,774, 776,778,780, 782,784 786,7S8,790,792,794,796,798,800,802,804, S06,808, 810 812,814,816,818,820, 822,
824,826,828, 830,832,834,836,838,840,842,844,846, 848,850 852 854, 856,858, 860,862,864,866, 868, 870,
872,874,876 878,880 882,884,886 888,890 892,894,896,898,900,902,904,906,908,910,912,914,916, 918, 920,922,924, 926,928 930,932,934,936,938,940,942,944,946,948, 950,952,954,956,958,960 962,9645 966 968, 970, 972, 974, 976, 978, 980, 982,984, 986, 9S8, 990, 992, 994, 995 998,1000, 1002,1004,1006 1008,1010, 1012, 1014, 1016,1018, 1020, 3022, 1024,1026 1028 1030, 1032, 1034, 1036, 1038, 1040, 1042, 1044, 1046, 1048
1050,1052,1054,1056,1058, 1060,1062, 1064,1066 1068,1070, 1072,1074,1076,1078, 1080,1082, 1084,1086,
1088, 1090,1092,1094, 1096 1098,1100,1102,1104,1106,1108,1110,1112,1114,1116 1118 1120, 1122,1124, 1126, 1128,1130,1132,1134,1136, 1138,1140, 1142, 1144, 1146, 1148,1150,1152 1154,1156 1158,1160,1162, 1164,1166,1168,1170,1172, 1174 1176 U78 1180 1182, 1184 1186, 1188, 1190 1192,1194, 1196, 1198,1200, 1202 1204, 1206,1208, 1210 1212, 1214, 1216, 1218 1220 1222, 1224, 1226, 1228, 1230s 1232, 1234, 1236, 1238,
1240,1242,1244,1246,1248, 1250,1252,1254,1256, 1258 1260,1262,1264,1266,1268 1270,1272 1274 1276,
1278,1280,1282,1284, 1286,1288,1290,1292, 1294,1296,1298,1300,1302, 1304, 1306,1308, 1310,1312,1314, 1316,1358, 1320,1322,1324, 1326,1328,1330, 1332,1334,1336,1338, 1340,1342, 1344,1346,1348, 1350,1352, 1354, 1356, 1358, 1360,1362, 1364,1366, 1368, 1370, 1372, 1374, 1376,1378,1380, 1382, 1384, 1386,1388, 1390, 1392,1394 1396,1398 1400, 1402,1404,1406, 1408,1410, 1412, 1414, 1416 1418 1420,1422, 1424,1426,1428,
1430 1432 1434, 1436 1438, 1440,1442,1444, 1446,1448,1450,1452,1454 1456,1458,1460 1462,1464, S466
1468 1470,1472,1474,1476,1478, 1480 1482 1484 i486 1488S1490,1492 1494 1496 1498,1500,1502,1504 1506,1508,1510, 1512,1514 1516,1518,1520, 1522, 1524,1526, 1528,1530,1532,1534 1536,153S, 1540,1542, 1544, 1546,1548,1550, 1552,1554,1556,1558,1560,1562,1564,1566,1568,1570, 1572, 5574, 1576, 1578,1580 1582 1584,1586,15S8,1590, 1592, 1594,1596,1598,1600,1602 1604, 1606 1608,1610 1612 1614,1616,1618,
1620 1622 1624,1626 1628, 1630,1632, 1634 1636 1638 1640,1642,1644 1646 1648,1650,1652, 1654,1656,
-77.

WO 2005/111066PCT/IB2005/001775
1658, 1660,1662, 1664, 1666,1668,1670, 1672,1674,1676, 1678, 1680,1682,1684, 1686, 1688, 1690, 1692, 1694,
1696, 1698, 1700,1702, 1704,1706, 1708,1710,1712, 1714,1716 1718, 1720,1722,1724, 1726, 1728, 1730, 1732,
1734, 1736, 1738, 1740, 1742,1744 1746,1748 1750 1752 1754,1756, 1758, 1760, 1762, 1764, 1766,1768,1770,
1772 1774, 1776, 1778, 1780, 1782 1784 1786,1788, 1790,1792, 1794 1796, 1798, 1800, 1802 1804, 1806, 1808,
1810, 1812, 1814, 1816, 1818, 1820, 1822, 1824, 1826, 1828, 1830, 1832, 1834, 1836, 1838, 1840, 1842, 1844, 1846,
1848,1850, 1852,1854,1856, 1858, 1860,1862,1864, 1866,1868 1870,1872,1874, 1876,1878,1880, 1882, 1884 1886,1888,1890 1892, 1894,1896, 1898,1900,1902, 1904 1906,1908, 1910,1912,1914, 1916,1918, 1920, 1922, 1924,1926,1928, 1930, 1932,1934, 1936,1938,1940,1942, 1944,1946 1948, 1950, 1952, 1954,1956, 1958, 1960, 1962, 1964, 1966, 1968, 1970, 1972, 1974, 1976, 1978, 1980, 1982, 1984, 1986, 1988, 1990, 1992, 1994, 1996, 199S,
2000, 2002, 2004, 2006, 2008, 2010, 2012, 2014,2016, 2018, 2020, 2022 2024, 2026,2028 2030,2032, 2034, 2036,
2038, 2040, 2042, 2044, 2046, 2048, 2050, 2052, 2054, 2056, 2058, 2060, 2062, 2064, 2066, 2068, 2070, 2072, 2074, 2076, 2078, 2080 2082, 2084, 2086, 2088, 2090,2092, 2094, 2096,2098, 2100, 2102,2104, 2106, 2108, 2110, 2112, 2114, 2116, 2118, 2120, 2122, 2124, 2126, 2128, 2130, 2132, 2134, 2136, 2138, 2140,2142, 2144, 2146, 2148, 2150, 2152,2154,2156 2158,2160,2162 2164 2166,2168 2170 2172 2174 2176 2178 2180 2182 2184 2186,2188
2190, 2192 2194 2196, 2198, 2200, 2202, 2204, 2206, 2208, 2210 2212 2214 2216, 2218, 2220, 2222 2224 2226,
2228 2230 2232 2234, 2236, 2238, 2240, 2242,2244, 2246, 2248, 2250,2252, 2254, 2256, 2258, 2260, 2262, 2264, 2266, 2268, 2270, 2272, 2274, 2276, 2278, 2280, 2282, 2284, 2286 2288 2290 2292, 2294, 2296 2298, 2300, 2302 2304, 2306 2308 2310, 2312, 2314, 2316, 2318, 2320, 2322, 2324, 2326 2328 2330 2332, 2334, 2336, 2338 2340 2342, 2344 2346 2348, 2350, 2352 2354, 2356, 2358,2360, 2362 2364, 2366, 2368, 2370, 2372, 2374, 2376, 2378,
2380, 2382, 2384, 2386, 2388, 2390, 2392, 2394, 2396, 2398, 2400, 2402, 2404, 2406, 2408, 2410, 2412, 2414, 2416,
2418, 2420, 2422, 2424, 2426, 2428, 2430, 2432, 2434, 2436 2438, 2440, 2442 2444 2446, 2448 2450, 2452, 2454, 2456 2458, 2460, 2462, 2464, 2466 2468, 2470 2472 2474, 2476 2478, 2480 2482, 2484, 2486, 2488 2490, 2492 2494 2496, 2498, 2500, 2502, 2504, 2506, 2508, 2510, 2512, 2514, 2516, 2518, 2520, 2522, 2524, 2526, 2528, 2530, 2532, 2534, 2536, 2538, 2540, 2542, 2544, 2546, 2548, 2550, 2552, 2554, 2556, 2558, 2560, 2562, 2564, 2566, 2568,
2570, 2572, 2574, 2576, 2578, 2580,2582, 2584, 2586 2588, 2590, 2592 2594 2596 2598, 2600 2602, 2604, 2606,
2608 2610,2612,2614 2616,2618 2620 2622 2624,2626 2628,2630 2632,2634 2636 2638 2640 2642 2644 2646, 2648, 2650, 2652, 2654, 2656, 2658, 2660, 2662, 2664, 2666, 2668, 2670, 2672, 2674, 2676, 2678, 2680, 2682, 2684, 2686, 2688, 2690, 2692, 2694, 2696, 2698, 2700, 2702, 2704, 2706, 2708, 2710, 2712, 2714, 2716, 2718, 2720, 2722, 2724, 2726, 2728 2730 2732 2734 2736 2738, 2740,2742 2744,2746 2748, 2750, 2752, 2754, 2756 2758
2760, 2762, 2764, 2766, 2768 2770, 2772 2774, 2776 2778 2780 2782, 2784, 2786 2788, 2790, 2792, 2794, 2796,
2798, 2800, 2802, 2804, 2806, 2808, 2810, 2812, 2814, 2816, 2818, 2820, 2822, 2824,2826, 2828, 2830, 2832, 2834, 2836, 2838, 2840, 2842, 2844, 2846, 2848, 2850, 2852, 2854, 2856, 2858 2860 2862 2864, 2866, 2868 2870, 2872, 2874 2876, 2878, 2880, 2882, 2884 2886, 2888, 2890 2892, 2894 2896 2898 2900 2902, 2904, 2906, 2908,2910, 2912 2914, 2916, 2918, 2920, 2922 2924~2926, 2928, 2930 2932, 2934 2936, 2938, 2940 2942, 2944, 2946, 2948,
2950 2952, 2954, 2956 2958, 2960, 2962 2964, 2966 2968, 2970, 2972, 2974 2976, 2978, 2980, 2982,2984, 2986,
2988, 2990, 2992, 2994, 2996, 2998, 3000, 3002, 3004,3006, 3008,3010, 3012, 3014 3016, 3018, 3020, 3022 3024, 3026, 3028, 3030,3032 3034 3036, 3038, 3040, 3042 3044,3046,3048, 3050, 3052, 3054,3056 3058, 3060,3062, 3064 3066, 3068 3070, 3072, 3074,3076 3078 3080, 3082, 3084 3086 3088, 3090 3092 3094 3096 3098, 3100, 3102,3104,3106,3108,3110,3112,3114,3116,3118,3120,3122,3124,3126 3128,3130,3132,3134,3136,3138,
3140, 3142, 3144, 3146, 3148, 3150, 3152, 3154, 3156,3158 3160, 3162, 3164,3166,3168, 3170 3172 3174, 3176,
-78-

WO 2005/111066PCT/IB2005/001775
3178, 3180, 3182, 3184, 3186, 3188, 3190, 3192,3194,3196,3198, 3200, 3202, 3204, 3206, 3208, 3210, 3212, 3214,
3216, 3218,3220, 3222, 3224,3226, 3228, 3230,3232 3234,3236, 3238, 3240, 3242 3244 3246, 3248, 3250, 3252,
3254, 3256, 32:>8, 3260, 3262,3264, 3266, 3268,3270, 3272, 3274, 3276, 3278, 3280, 3282, 3284, 3286 3288, 3290,
3292, 3294, 3296, 3298, 3300, 3302, 3304, 3306, 3308, 3310, 3312, 3314, 3316, 3318, 3320, 3322, 3324, 3326, 3328,
3330, 3332, 3334, 3336, 3338, 3340, 3342, 3344,3346, 3348, 3350, 3352, 3354, 3356, 3358, 3360, 3362, 3364, 3366,
3368, 3370, 3372, 3374, 3376,3378, 3380, 3382, 3384, 3386, 3388, 3390, 3392 3394, 3396, 3398, 3400,3402,3404, 3406, 3408,3410, 3412, 3414, 3416, 3418, 3420, 3422,3424,3426, 3428 3430, 3432, 3434, 3436, 3438, 3440 3442 3444, 3446, 3448, 3450, 3452, 3454, 3456, 3458, 3460, 3462, 3464, 3466, 3468, 3470,3472, 3474, 3476, 3478, 3480, 3482 3484 3486 3488 3490 3492, 3494 3496, 3498, 3500, 3502, 3504, 3506, 3508, 3510, 3512, 3514, 3516, 3518,
3520, 3522, 3524, 3526, 3528, 3530, 3532,3534, 3536,3538, 3540, 3542, 3544, 3546, 3548, 3550, 3552, 3554, 3556,
3558, 3560, 3562, 3564, 3566, 3568 3570 3572 3574 3576 3578, 3580 3582, 3584 3586, 3588, 3590,3592, 3594, 3596, 3598, 3600, 3602, 3604, 3606, 3608, 3610, 3612,3614, 3616, 3618, 3620, 3622,3624, 3626, 3628, 3630,3632, 3634, 3636, 3638,3640, 3642, 3644, 3646, 3648, 3650, 3652, 3654, 3656, 3658, 3660, 3662, 3664,3666, 3668, 3670, 3672, 3674, 3676, 3678 3680, 3682, 3684, 3686, 3688, 3690, 3692, 3694 3696 3698,3700 3702, 3704, 3706, 3708,
3710 3712 3714 3716, 3718 3720, 3722, 3724, 3726, 3728, 3730, 3732, 3734, 3736,3738, 3740, 3742, 3744, 3746,
3748, 3750 3752, 3754 3756 3758, 3760 3762, 3764, 3766, 3768, 3770 3772, 3774, 3776, 3778, 3780, 3782, 3784, 3786, 3788, 3790, 3792, 3794, 3796, 3798, 3800, 3802, 3804, 3806, 3808, 3810, 3812, 3814, 3816, 3818, 3820,3822, 3824, 3826, 3828, 3830, 3832, 3834, 3836, 3838, 3840, 3842, 3844, 3846, 3848,3850, 3852, 3854, 3856, 3858, 3860, 3862, 3864, 3866 3868, 3870, 3872, 3874, 3876, 3878,3880, 3882, 3884 3886 3888 3890, 3892, 3894 3896,3898,
3900, 3902, 3904, 3906, 3908, 3910, 3912, 3914, 3916,3918, 3920, 3922, 3924,3926, 3928, 3930, 3932, 3934, 3936,
3938, 3940, 3942, 3944, 3946, 3948, 3950, 3952, 3954, 3956,3958, 3960, 3962, 3964, 3966 3968, 3970, 3972, 3974 3976, 3978, 3980, 3982 3984 3986, 3988 3990 3992, 3994,3996,3998, 4000 4002, 4004, 4006, 4008, 4010, 4012 4014, 4016, 4018, 4020, 4022, 4024 4026 4028 4030 4032 4034, 4036, 4038, 4040, 4042, 4044, 4046, 4048, 4050, 4052, 4054, 4056, 4058, 4060, 4062, 4064,4066,4068, 4070, 4072, 4074, 4076, 4078, 4080, 4082, 4084, 4086, 4088,
4090,4092,4094,4096, 4098, 4100, 410?, 4104, 4106, 4108,4110 4112,4114 4116 4118 4120,4122 4124,4126
4128, 4130, 4132, 4134, 4136 4138, 4140, 4142, 4144, 4146,4148, 4150, 4152, 4154, 4156 4158, 4160, 4162, 4164, 4166, 4168,4170 4172, 4174, 4176 4178,4180, 4182, 4184,4186, 4188, 4190, 4192, 4194,4196, 4198,4200, 4202, 4204 4206,4208, 4210, 4212, 4214, 4216, 4218, 4220, 4222, 4224, 4226, 4228, 4230, 4232, 4234, 4236, 4238, 4240, 4242, 4244, 4246, 4248, 4250, 4252, 4254, 4256, 4258, 4260, 4262, 4264, 4266, 4268, 4270, 4272, 4274 4276, 4278,
4280, 4282, 4284 4286 4288, 4290, 4292,4294,4296, 4298, 4300, 4302, 4304, 4306, 4308 4310, 4312,4314, 4316,
4318, 4320 4322 4324 4326 4328 4330, 4332, 4334, 4336, 4338, 4340, 4342, 4344, 4346, 4348, 4350, 4352, 4354, 4356, 4358, 4360 4362, 4364, 4366, 4368, 4370,4372, 4374 4376, 4378, 4380,4382, 4384, 4386 4388,4390 4392 4394,4396,4398,4400 4402 4404 4406,4408 4410 4412,4414 4416,4418,4420 4422 4424 4426,4428,4430 4432, 4434, 4436,4438, 4440, 4442, 4444, 4446,4448, 4450, 4452, 4454 4456 4458, 4460, 4462, 4464, 4466, 4468,
4470, 4472, 4474 4476, 4478, 4480 4482, 4484, 4486, 4488, 4490, 4492, 4494,4496, 4498, 4500, 4502, 4504, 4506,
4508, 4510,4512,4514, 4516, 4518, 4520, 4522 4524, 4526, 4528, 4530, 4532, 4534, 4536, 4538 4540,4542, 4544 4546, 4548, 4550, 4552, 4554, 4556 4558, 4560 4562 4564 4566 4568 4570 4572, 4574, 4576, 4578,4^80, 4582, 4584, 4586 4588 4590, 4592, 4594, 4596 4598 4600, 4602 4604 4606 4608 4610, 4612, 4614 4616, 4618 4620, 4622 4624,4626,4628,4630, 4632, 4634 4636, 4638,4640 4642, 4644, 4646, 4648,4650, 4652, 4654,4656, 4658,
4660 4662, 4664, 4666, 4668, 4670, 4672, 4674, 4676, 4678, 4680, 4682, 4684, 4686, 4688 4690, 4692, 4694, 4696
-79-

PCT7IB2005/001775
4698, 4700, 4702 4704, 4706 4708, 4710,4712, 4714, 4716, 4718, 4720, 4722, 4724, 4726, 4728,4730, 4732, 4734,
4736, 4738, 4740 4742, 4744, 4746, 4748, 4750, 4752, 4754, 4756, 4758, 4760, 4762 4764 4766, 4768, 4770, 4772,
4774, 4776, 4778, 4780, 4782, 4784, 4786, 4788, 4790,4792, 4794, 4796, 4798, 4800, 4802, 4804 4806, 4808, 4810,
4812, 4814, 4816 4818 4820 4822, 4824 4826, 4828 4830 4832 4834, 4836 4838 4840 4842, 4844 4846, 4848,
4850, 4852, 4854 4856, 4858, 4860 4862, 4864, 4866, 4868, 4870, 4872, 4874, 4876, 4878, 4880, 4882, 4884, 4886,
4888, 4890, 4892, 4894, 4896, 4898, 4900, 4902,4904, 4906, 4908, 4910, 4912, 4914, 4916, 4918, 4920, 4922, 4924,
4926, 4928, 4930, 4932, 4934, 4936, 4938, 4940, 4942, 4944, 4946, 4948, 4950, 4952, 4954, 4956, 4958, 4960, 4962
4964, 4966, 4968 4970 4972, 4974, 4976, 4978, 4980, 4982, 4984, 4986, 4988, 4990, 4992, 4994, 4996, 49% 5000,
5002, 5004 5006, 5008 5010 5012, 5014, 5016, 5018, 5020, 5022, 5024, 5026, 5028, 5030, 5032, 5034, 5036, 5038,
5040, 5042, 5044, 5046, 5048, 5050, 5052, 5054, 5056, 5058, 5060, 5062 5064, 5066 5068, 5070 5072, 5074, 5076
5078,5080,5088,5089,5090,5091,5092,5093 5094 & 5095
2 The polypeptide of claim 1 comprising one or more of amino acid sequences SEQ ID NOS 2,4 6,8,10,12, 14,16,18, 20,22,24,26,28,30, 32,34,36,38,40,42,44 46,48,50,52,54,56, 58,60,62,64,66,68,70,72,74,76,78 80 82 84, 86 88 90 92 94 96 98 100 102,104 106 108 HO, 112 114 116 118, !20,122 124 126 128 130 132 134,
136,138,140,142,144 146,148, 150 152,154 b6, 158 160,162 164,166 168,170,172 174,176,178,180, 182,
184, 186,188, 190, 192, 194, 196, 198, 200, 202,204 206 208,210,212, 214,216,218,220,222,224,226, 228, 230 232,234,236, 238, 240,242, 244, 246, 248 250,252 254,256,258,260 262,264,266,268 270,272,274,276,278, 280 282 284 286 288 290, 292, 294, 296, 298, 300, 302, 304, 306, 308 310, 312, 314 316 318, 320, 322, 324, 326, 328, 330, 332, 334 336, 338 340 342 344, 346 348 350 352, 354, 356, 358, 360, 362, 364, 366, 368, 370, 372, 374,
376, 378,380, 382,384,386,388,390, 392, 394,396,398, 400, 402,404,406,408, 410,412,414 416,418,420,422,
424,426,428, 430,432,434,436,438 440,442 444,446, 448, 450,452, 454 456,458,460,462,464,466, 468,470, 472 474,476,478,480 482 484,486, 488,490 492, 494, 496,498 500 502 504, 506, 508,510,512,514,516, 518, 520,522,524,526, 528, 530, 532, 534, 536,538, 540,542 544 546,548,550, 552, 554, 556, 55S, 560, 562,564, 566, 568, 570, 572, 574, 576, 578, 580, 582, 5S4,586, 588, 590 592,594, 596,598, 600 602,604, 606 608, 610 612 614
616, 618, 620 622, 624, 626 628 630; 632, 634 636, 638 640, 642, 644 646, 648 650 652, 654 656,658, 660 662
664, 666,668, 670,672,674,676, 678, 680 682,684, 686, 688, 690, 692, 694 696 698, 700,702,704,706,708, 710, 712, 714,716, 718, 720, 722,724, 726,728, 730,732 734 736, 738, 740,742,744,746,748,750,752,754 756 758, 760, 762, 764, 766, 768, 770, 772, 774, 776,778 780, 782, 784, 786, 788 790, 792, 794 796, 798 800, 802 804, 806 808, 810, 812,814, 816, 818, 820, 822, 824,826, 828,830, 832, 834 836, 838 840, 842, 844 846,848 850, 852 854,
856 858 860 862, 864, 866, 86S, 870, 872, 874 876 878 880, 882,884,886, 888, 890 892, 894, 896, 898, 900,902
904,906,908,910 912 914,916, 918,920,922,924 926, 928,930,932 934, 936, 938, 940, 942,944,946 948 950, 952,954,956, 958, 960,962,964, 966,968,970 972 974, 976, 978,980 982, 984, 986, 988,990,992 994 996,998 1000, 1002, 1004, 1006, 1008, 1010, 1012 1014, 1016, 1018, 1020, 1022 1024, 1026 1028 1030 1032, 1034 1036, 1038 1040 1042 1044 1046 1048, 1050 1052 1054, 1056 1058 1060, 1062, 1064, 1066 1068, 1070, 1072, 1074
1076, 1078 1080, 1082, 1084, 1086, 1088 1090, 1092, 1094, 1096, 1098, 1100, 1102, 1104, 1106, 1108, 1110, 1112
1114,1116 1118,1120,1122,1124,1126,1128,1130,1132 1134,1136 1138 1140,1142,1144,1146,1148,1130 1152,1154,1156,1158 1160 1162,1164,1166,1168,1170,1172,1174 1176 1178 1180,1182,1184,1186 1188, 1190, 1192, 1194, 1196, 1198 1200 1202, 1204 1206, 1208 1210 1212 1214, 1216 1218, 1220, 1222, 1224,1226, 1228, 1230, 1232, 1234, 1236 1238, 1240, 1242, 1244, 1246, 1248, 1250, 1252, 1254, 1256, 1258, 1260, 1262,1264
1266,1268 1270 1272 1274 1276 1278 1280 1282 1284 1286 1288 1290,1292,1294 1296 1298 1300,3302
80-

WO 2005/111066PCT/IB2005/001775
1304,1306, 1308,1310, 1312, 1314,1316,1318,1320, 1322,1324,1326,1328, 1330,1332, 1334, 1336,1338, 1340,
1342, 1344, 1346 1348, 1350, 1352 1354, 1356, 1358, 1360, 1362, 1364, 1366 I36S, 1370, 1372 1374, 1376, 1378,
1380 1382, 1384, 1386, 1388, 1390 1392, 1394, 1396, 1398, 1400 1402, 1404 1406, 1408, 1410, 1412,1414, 1416
1418,1420,1422,1424, 1426,1428,1430, 1432, 1434,1436,1438,1440, 1442, 1444,1446,1448, 1450,1452, 1454,
1456, 1458, 1460, 1462, 1464, 1466, 1468, 1470, 1472, 1474, 1476, 1478, 1480, 1482, 1484, 1486, 1488, 1490 1492
1494, 1496, 1498, 1500, 1502,1504, 1506, 1508,1510, 1512,1514,1516 1518, 1520, 1522, b24, 1526,1528, 1530,
1532, 1534,1536 1538, 1540, 1542,1544, 1546,1548,1550,1552,1554, 1556, 1558,1560, b62,1564,1566,1568,
1570, 1572, 1574, 1576, 1578, 1580,1582, 1584,1586, 1588, 1590, 1592, 1594, 1596 1598, 1600, 1602, 1604, 1606,
1608,1610, 1612, 1634, 1616, 1618, 1620 1622 1624, 1626, 1628,1630, 1632 1634 1636 1638 1640 1642, 1644
1646, 1648, 1650, 1652, 1654, 1656, 1658, 1660 3662, 1664,1666, 1668, 1670 1672,1674,1676, 1678,1680 1682,
1684, 1686, 1688, 1690, 1692, 1694, 1696, 1698, 1700, 1702, 1704, 1706, 1708, 1710,1712, 1714 1716,1718, 1720,
1722, 1724 1726, 1728 1730, 1732, 1734, 1736,1738 1740, 1742,1744, 1746, 1748,1750, 1752, 1734,1756, 1758,
1760, 1762, 1764, 1766, 1768, 1770, 1772, 1774 1776, 1778 1780 1782 1784 1786 1788 1790, 1792,1794, 1796,
1798 1800, 1802 1804 1806 1808 1810 1812 1814 1816 1818 1820 1822 1824, 1826 1828 1830 1832 1834
1836, 1838, 1840, 1842, 1844 1846 1848, 1850 1852, 1854, 1856, 1858 I860, 1862, 1864, 1866 1868, 1870, 1872
1874, 1876, 1878, 1880, 1882, 1884, 1886, 1888, 1890, 1892, 1894, 1896, 1898, 1900, 1902,1904, 1906, 1908, 1910,
1912, 1914, 1916, 1918, 1920, 1922, 1924, 1926, 1928, 1930, 1932, 1934, 1936 1938, 1940, 1942, 1944, 1946 I94S
1950 1952 1954, 1956, 1958, 1960, 1962, 1964 1966 1968, 1970, 1972,1974, 1976,1978,1980, 1982,1984, 1986,
1988 1990 1992, 1994, 1996, 1998 2000 2002, 2004, 2006, 2008 2010, 2012, 2014, 2016, 2018, 2020, 2022, 2024,
2026, 2028, 2030, 2032 2034, 2036, 2038, 2040, 2042, 2044, 2046, 2048, 2050, 2052, 2054, 2056 2058 2060, 2062,
2064 2066 2068, 2070, 2072, 2074 2076 2078 2080 2082 2084 2086 2088, 2090, 2092 2094 2096 2098 2100
2102,2104,2106,2108,2130 2112 2114,2116 2118 2120,2122 2124 2126,2128,2130,2132 2134,2136 2138,
2140, 2142, 2144, 2146, 2148, 2150, 2152, 2154 2156, 2158, 2160,2162,2164, 2166, 2168, 2170 2172, 2174,2176,
2178, 2180, 2182, 2184, 2186, 2188 2190, 2192,2194 2196 2198, 2200 2202, 2204, 2206, 2208 2210, 2212, 2214,
2216, 2218 2220 2222 2224 2226 2228 2230, 2232 2234 2236, 2238 2240 2242 2244 2246 2248 2250 2252
2254 2256, 2258 2260 2262 2264 2266 2268, 2270 2272 2274, 2276 2278, 2280, 2282, 2284 2286, 2288 2290,
2292, 2294, 2296, 2298, 2300, 2302, 2304, 2306, 2308,2310, 2312, 2314, 2316, 2318, 2320, 2322 2324, 2326 2328
2330, 2332, 2334, 2336, 2338, 2340, 2342, 2344, 2346, 2348, 2350, 2352, 2354, 2356, 2358, 2360 2362, 2364 2366,
2368 2370 2372,2374 2376 2378,2380,2382,2384 2386,2388,2390,2392,2394,2396,2398 2400,2402,2404,
2406, 2408, 2410, 2412, 2414, 2416, 2418, 2420, 2422, 2424, 2426, 2428, 2430, 2432, 2434, 2436, 2438, 2440, 2442,
2444, 2446, 2448 2450, 2452 2454, 2456, 2458, 2460, 2462, 2464, 2466, 2468, 2470, 2472, 2474, 2476 2478 2480
2482, 2484, 2486, 2488, 2490, 2492 2494, 2496, 2498, 2500, 2502 2504, 2506, 2508, 2510 2512 2514, 2516, 2518,
2320, 2522, 2524, 2526, 2528 2530, 2532, 2534, 2536, 2538, 2540, 2542, 2544, 2546, 2548, 2550 2552, 2554, 2556,
2558 2560 2562, 2564 2566 2568, 2570, 2572 2574, 2576, 2578 2580, 2582, 2584, 2586, 2588, 2590, 2592, 2594,
2596, 2598, 2600, 2602, 2604, 2606, 2608, 2610, 2612, 2614, 2616, 2618, 2620, 2622, 2624, 2626, 2628, 2630, 2632,
2634, 2636, 2638 2640, 2642 2644, 2646 2648 2650 2652 2654 2656 2658 2660 2662, 2664 2666, 2668 2670
2672, 2674, 2676, 2678, 2680 2682, 2684, 2686, 2688 2690, 2692, 2694, 2696, 2698, 2700 2702, 2704, 2706 2708
2710, 2712 2714, 2716 2718, 2720, 2722, 2724, 2726,2728 2730 2732, 2734, 2736, 2738, 2740 2742, 2744, 2746,
2748, 2750, 2752, 2754, 2756, 2758, 2760, 2762, 2764, 2766, 2768, 2770, 2772,2774, 2776, 2778, 2780, 2782, 2784,
2786 2788, 2790 2792 2794 2796 2798 2800 2802 2804 2806 2808 2810 2812 2814, 2816 2818 2820 2822
81-

WO 2005/111066PCT/IB2005/001775
2824, 2826,2828, 2830, 2832, 2834, 2836, 2838, 2840, 2842, 2844, 2846, 2848, 2850, 2852,2854, 2856, 2858, 2860,
2862, 2864, 2866, 2868, 2870, 2872, 2874, 2876, 2878, 2880, 2882, 2884 2886, 2888 2890 2892, 2894 2896 2898,
2900, 2902, 2904, 2906, 2908, 2910, 2912, 2914 2916 2918 2920 2922, 2924 2926, 2928, 2930, 2932, 2934 2936,
2938, 2940, 2942, 2944, 2946, 2948, 2950,2952, 2954, 2956, 2958, 2960, 2962,2964, 2966, 2968, 2970, 2972,2974,
2976 2978,2980, 2982, 2984, 2986, 2988,2990, 2992, 2994, 2996, 2998,3000,3002, 3004, 3006,3008,3010, 3012,
3014, 3016, 3018, 3020,3022, 3024, 3026 3028, 3030 3032, 3034 3036,3038,3040, 3042, 3044, 3046,3048,3050
3052, 3054 3056, 3058,3060, 3062 3064,3066, 3068, 3070, 3072, 3074,3076 3078 3080, 3082, 3084, 3086, 3088,
3090, 3092, 3094, 3096,3098,3100,3302,3104, 3106, 3108, 3110, 3112,3114,3116, 3118, 3120, 3122, 3124,3126,
3128, 3130, 3132,3134,3136,3138, 3140,3142, 3144, 3146,3148, 3150, 3152, 3154, 3156, 3158, 3160 3162, 3164,
3166, 3168, 3170, 3172,3174,3176, 3178,3180,3182,3184, 3186, 3188,3190, 3192, 3194, 3196 3198, 3200, 3202,
3204,3206,3208, 3210,3212,3214, 3216,3218 3220,3222, 3224, 3226,3228,3230,3232, 3234, 3236, 3238,3240, 3242 3244 3246, 3248 3250 3252, 3254,3256, 3258,3260, 3262, 3264,3266,3268,3270, 3272, 3274, 3276, 3278, 3280, 3282, 3284,3286, 3288, 3290, 3292, 3294, 3296, 3298, 3300, 3302,3304,3306, 3308, 3310, 3312, 3314, 3316, 3318, 3320,3322, 3324, 3326, 3328, 3330,3332,3334, 3336, 3338 3340, 3342 3344, 3346, 3348 3350 3352, 33^4
3356, 3358, 3360, 3362, 3364, 3366, 3368, 3370, 3372, 3374, 3376, 3378, 3380, 3382, 3384, 3386, 3388, 3390, 3392,
3394, 3396, 3398,3400, 3402,3404 3406 3408, 3410,3412, 3414, 3416, 3418, 3420,3422, 3424,3426, 3428 3430, 3432, 3434, 3436, 3438, 3440, 3442,3444,3446, 3448, 3450, 3452, 3454, 3456, 3458,3460,3462,3464, 3466 3468, 3470, 3472,3474, 3476, 3478, 3480, 3482, 3484 3486 3488, 3490, 3492 3494,3496,3498,3500, 3502,3504 3506, 3508,3510,3512, 3514, 3516 3518, 35J0, 3522,3524, 3526 3528, 3530,3532,3534,3536,3538, 3540, 3542 3544,
3346 3548, 3550, 3552, 3554, 3556, 3558,3560,3562, 3564, 3566,3568,3570,3572,3574,3576, 3578 3580 3582,
3584, 3586, 3588, 3590 3592, 3594, 3596, 3598 3600 3602, 3604, 3606 3608, 3610 3612, 3614 3616 3618 3620, 3622 3624,3626, 3628, 3630 3632, 3634,3636 3638 3640, 3642, 3644,3646,3648,3650, 3652, 3654,3656 3658, 3660 3662 3664 3666 3668, 3670, 3672,3674 3676, 3678, 3680 3682,3684,3686,3688,3690, 3692, 3694, 3696, 3698,3700, 3702, 3704 3706 3708, 3710, 3712, 3714,3716, 3718, 3720,3722,3724,3726, 3728,3730 3732, 3734,
3736, 37J8, 3740, 3742,3744, 3746, 3748, 3750, 3752, 3754 3756, 3758, 3760,3762,3764, 3766 3768, 3770, 3772,
3774 3776,3778, 3780 3782, 3784 3736, 3788,3790 3792, 3794, 3796 3798,3800,3802, 3804,3806,3808, 3810, 3812,3814, 3816,3818,3820, 3822 3824, 3826, 3828, 3830, 3832, 3834, 3836,3838, 3840, 3842,3844 3846, 3848, 3850, 3852, 3854, 3856, 3858, 3860, 3862, 3864, 3866, 3868, 3870, 3872 3874 3876 3878 3880, 3882 3884 3886 3888,3890,3892,3894 3896,3898 3900,3902 3904,3906 3908,3910 3912,3914 3916 3918,3920,3922,3924,
3926 3928,3930, 3932, 3934 3936, 3938 3940 3942 3944 3946 3948 3950 3952 3954, 3956 3958, 3960, 3962,
3964, 3966, 3968, 3970 3972, 3974, 3976, 3978, 3980, 3982, 3984, 3986, 3988, 3990, 3992, 3994 3996, 399S 4000 4002, 4004,4006 4008, 4010, 4012, 4014,4016,4018, 4020, 4022,4024, 4026, 4028, 4030, 4032, 4034 4036 4038, 4040, 4042, 4044, 4046, 4048, 4050, 4052, 4054, 40^6 4058, 4060, 4062, 4064, 4066, 4068, 4070 4072, 4074, 4076, 4078,4080,4082,4084 4086,4088 4090,4092,4094 4096 4098 4100 4102,4104,4106,4108 4110,4112,4114,
4116, 4118, 4120, 4122, 4124, 4126, 4128, 4130,4132, 4134, 4136, 4138, 4140, 4142, 4144, 4146 4148, 4150, 4152,
4154, 4156, 4158, 4160, 4162, 4164, 4166,4168,4170, 4172,4174, 4176, 4178, 4180, 4182, 4184 4186, 4188 4190, 4192,4194,4196 4198 4200,4202 4204,4206 4208 4210,4212,4214 4216,4218 4220,4222 4224,4226 4228, 4230 4232, 4234, 4236 4238 4240 4242 4244 4246 4248, 42DO 4252 4254, 4256 4258 4260 4262 4264, 4266, 4268 4270, 4272, 4274, 4276 4278 4280, 4282, 4284, 4286, 4288, 4290 4292, 4294 4296, 4298 4300, 4302, 4304,
4306, 4308, 4310, 4312, 4314, 4316, 4318, 4320, 4322, 4324, 4326, 4328 4330, 4332 4334 4336, 4338 4340 4342,
-82-

WO 2005/111066PCT/IB2005/001775
4344, 4346,4348,4350, 4352, 4354, 4356,4358, 4360, 4362, 4364, 4366, 4368 4370, 4372, 4374, 4376 4378, 4380,
4382, 4384, 4386,4388, 4390, 4392 4394 4396, 4398, 4400, 4402, 4404,4406,4408, 4410, 4412, 4414, 4416, 4418,
4420, 4422, 4424, 4426, 4428,4430, 4432,4434,4436, 4438, 4440, 4442, 4444, 4446, 4448, 4450, 4452, 4454, 4456,
4458, 4460, 4462, 4464, 4466, 4468, 4470,4472, 4474,4476, 4478, 4480,4482, 4484, 4486, 4488, 4490, 4492,4494,
4496,4498 4500 4502 4504,4506 4508 4510,4512,4514 4516 4518 4520,4522,4524 4526,4528,4530 4532
4534, 4536, 4538, 4540 4542 4544,4546 4548, 4550 4552, 4554, 4556, 4558, 4560, 4562, 4564, 4566, 4568,4570 4572, 4574, 4576,4578, 4580, 4582,4584,4586,4588, 4590, 4592, 4594, 4596,4598, 4600, 4602, 4604, 4606,4608, 4610, 4612, 4614, 4616, 4618, 4620, 4622, 4624, 4626, 4628, 4630, 4632, 4634, 4636, 4638, 4640, 4642, 4644, 4646, 4648, 4650, 4652 4654, 4656, 4658, 4660 4662, 4664, 4666, 4668, 4670, 4672, 4674, 4676, 4678 4680, 4682,46S4,
4686 4688, 4690, 4692, 4694,4696 4698 4700,4702 4704, 4706 4708, 4710,4712, 4714, 4716, 4718 4720 4722,
4724, 4726, 4728 4730, 4732,4734, 4736,4738, 4740 4742, 4744, 4746, 4748, 4750, 4752, 4754, 4756, 4758,4760 4762, 4764, 4766,4768, 4770, 4772,4774,4776, 4778 4780, 4782, 4784, 4786,4788, 4790,4792 4794,4796, 4798, 4800, 4802, 4804,4806, 4808, 4810, 4812, 4814, 4816, 4818, 4820, 4822, 4824, 4826, 4828, 4830, 4832, 4834, 4836 4838, 4840 4842 4844 4846 4848 4850 4852, 4854 4856, 4858, 4860, 4862 4864 4866, 4868, 4870, 4872, 4874
4876, 4878, 4880, 4882, 4884, 4886, 48S8, 4890, 4892, 4894, 4896, 4898, 4900, 4902, 4904, 4906, 4908, 4910, 4912,
4914, 4916, 4918, 4920, 4922 4924 4926 4928, 4930 4932, 4934 4936 4938 4940, 4942 4944 4946 4948 4950 4952, 4954 4956,4958, 4960, 4962, 4964, 4966, 4968, 4970 4972, 4974, 4976, 4978,4980, 4982, 4984, 4986, 4988 4990, 4992, 4994, 4996, 4998, 5000, 5002, 5004, 5006, 5008, 5010, 5012, 5014, 5016, 5018, 5020, 5022, 5024, 5026, 5028, 5030, 5032, 5034, 5036, 5038, 5040, 5042, 5044, 5046, 5048, 5050, 5052, 5054, 5056, 5058, 5060, 5062 5064
5066 5068 5070 5072 5074 5076 5078 5080 5088 5089, 5090,5091 5092 5093 5094 & 5095
3 A poiypcptide comprising a fragment of at least 7 consecutive amino acids from one or more of SEQ ID KOS 1566, 5095,1570 5094,1574, 5903,1578,5092,2,4, 6, 8,10,12,14,16,18,20,22,24,26, 28 30,32,34,36,38,40,42,44, 46, 48 50 52,54, 56, 38, 60, 62,64,66,68 70,72,74,76,78,80,82 84 86 88 90,92 94,96 98,100,102, 104, 106 308 110 112 114,116 118,120 122 \% 126,128,130,132,134,136,138,140,142,144 146,148,150 152 154,
156,158 160, 162, 164, 166, 168 170, 172 174 176,178 180, 182, 384, 186, 188, 190, 192, 194, 196, 198,200,202
204,206,208 210 212,214,216,218 220 222,224,226 228 230,232,234,236 238 240,242,244 246 248,250 252, 254, 256, 258 260 262 264 266 268 270,272 274 276 278,280 282,284,286 288,290,292 294 296 298 300, 302,304, 306, 308, 310,312,314 316 318 320,322, 324,326,328 330,332,334,336, 3J8, 340,342,344 346, 348, 350,352, 354, 356, 358,360, 362,364 366,368,370, 372,374,376,378,380,382,384,386,388,390, 392,394,
396, 398, 400, 402, 404, 406, 408, 410, 412, 414 416, 418, 420, 422, 424, 426, 428, 430, 432 434,436 43S 440, 442
444 446 448, 450 452 454 456 458 460 462,464,466 468 470 472 474, 476, 478,480, 482 484 486,488,490 492, 494,496 498,500,502 504, 506 508 510 512,514 516 518, 520,522, 524, 526, 528, 530,532, 534, 536, 538, 540, 542, 544, 546, 548, 550, 552,554, 5:>6 558,560,562, 564, 566, 568, 570,572,574, 576,578, 580, 582, 584,586, 588, 590, 592, 594, 596, 598, 600 602, 604, 606, 608,610, 612,614,616 618, 620,622, 624, 626,628,630, 632, 634,
636, 638, 640 642 644, 646, 648, 650, 652, 654, 656 658, 660, 662 664, 666,668 670, 672 674,676,678, 680 682
684 686 688 690, 692, 694 696, 698 700, 702 704 706,708 710 712, 714,716 718,720 722, 724,726, 728,730, 732, 734, 736, 738, 740, 742, 744, 746 748, 750, 752,754, 756, 758,760,762,764,766, 768,770,772,774,776,778, 780, 782, 784, 786, 788, 790, 792, 794, 796, 798, 800, 802, 804, 806, 808, 810 812, S14, 816, 818, 820, 822, 824, 826, 828 830 832, 834 S36 838 840, 842, 844, 846 848 850 852, 854 856, 858, 860, 862,864, 866 868, 870 872, 874,
876 878,880, 882 884, 886,888 890, 892 894 896 898 900 902 904, 906 908, 910 912,914, 916,918,920, 922
-83-

WO200V111066PCT/IB2005/001775
924,926,928,930,932,934, 936, 938,940, 942,944,946, 948,950,952,954 956, 958 960 962 964, 966, 968, 970,
972,974, 976,978, 980, 982, 984, 986, 988,990,992,994, 996,998,1000 1002,1004,1006,1008,1010,1012,1014, 1016 1018 1020 1022 1024 1026 1028,1030,1032,1034,1036, 1038, 1040, 1042, 1044, 1046,1048,1050,1052, 1054, 1056, 1058, 1060, 1062, 1064, 3066, 1068, 1070, 1072, 1074, 1076, 1078, 1080, 1082 1084, 1086 1088, 1090 1092, 1094, 1096, 1098, 1100, 1102, 1104,1106, 1108 1110,1112 1114, 1116,1118 1120, 3122,1124,1126, 1128, 1130,1132,1134, 1136, 1138, 1140 1142,1144,1146 1148 1150,1152 1154,1156,1158 1160,1162, 1164, 1166, 1168 1170 1172, 1174 1176, 1178 1180 1182, 1184, 1186, 1188, 1190, 1192 1194, 1196, 1198, 1200, 1202, 1204 1206,1208,1210, 1212, 1214,1216,1218,1220, 1222, 1224,1226,1228,1230 1232,1234, 1236,1238 1240 1242, 1244, 1246, 1248, 1250, 1252, 1254, 1256,1258, 1260, 1262 1264, 1266, 1268, 1270, 1272, 1274, 1276, 1278 1280,
1282, 1284, 1286, 1288, 1290, 1292, 1294, 1296, 1298 1300, 1302, 1304 1306 1308, 1310, 1312, 1314, 1316, 1318, 1320, 1322, 1324, 1326 1328, 1330, 1332,1334, 1336 1338, 1340, 1342, 1344, 1346, 1348,1350, 1352, 1354,1356, 13^8, 1360, 1362, 1364, 1366, 1368, 1370, 1372, 1374 1376, 1378, 1380, 1382, 1384 1386 1388 1390 1392, 3394, 1396, 1398, 1400, 1402, 1404, 1406, 1408, 1410, 1412, 1414, 1416 1418, 1420, 1422 1424, 1426, 1428, 1430 1432, 1434,1436, 1438, 1440 1442 1444, 3446, 1448, 3450 1452, 1454, 1456, 1458, 1460, 1462, 1464, 1466, 1468 1470
1472,1474,1476, 1478, 3480, 1482,1484, 1486, 1488, 1490, 1492, 1494, 1496, 1498, 1500, 1502, 1504, 1506, 1508, 1510 1512 1514, 1516 1518, 1520, 1522, 1524, 1526 1528, 1530, 1532 1534, 1536 1538, 1540, 1542, 1544, 1546, 1548, 1550, 1552, 1554, 1556, 1558 1560, 1562 1564, 3566, 1568, 1570 1572,1574 1576, 1578 1580, 1582, 1584, 1586, 1588 1590, 1592 1594, 1596 1598, 1600, 1602, 1604, 1606, 1608, 1610, 1612, 1614, 1616, 1618, 1620, 3622, 1624, 1626 1628 1630,1632,1634,1636,1638,1640, 1642,1644, 1646,1648,1650 1652,1654, 1656 3658, 1660
1662, 1664, 1666, 1668, 1670, 1672, 1674, 1676, 1678, 1680, 1682, 3684, 1686, 1688, 1690, 1692, 1694 1696, 1698 1700, 1702, 1704, 1706, 1708, 1710, 3712, 3714 1716 1718, 1720 1722, 1724 3726, 1728, 1730, 1732 1734, 1736, 1738, 1740 1742 1744, 1746, 1748, 1750, 1752, 1754, 1756, 1758, 1760, 1762, 1764, 1766, 1768, 1770 1772, 1774, 1776 1778 1780 1782 1784 1786, 1788, 1790 1792, 1794 3796 1798 1800 3802 1804 1806 1808 1810 1812, 1814, 1816, 1818, 1820, 1822, 1824,1826 1828,1830, 1832,1834, 1836, 1838, 1840, 1842, 1844,1846, 1848,1850,
1852, 1854, 1856, 1858, I860, 1862, 1864, 3866, 1868, 1870, 1872, 3874, 1876, 1878, 1880, 1882, 1884, 1886, 1888, i890, 1892, 1894, 1896, 1898 1900 1902 1904, 1906 3908, 1910 1912, 1914, 1916, 1918, 1920, 1922, 1924, 1926 1928 1930, 1932, 1934, 1936, 1938, 1940, 3942, 1944, 1946, 1948, 1950, 19:>2, 1954, 1956, 3958, I960, 1962, 1964, 1966 3968, 1970, 1972, 1974, 1976, 1978 1980, 1982, 1984, 1986, 3988, 1990 1992, 1994 1996 1998,2000,2002, 2004 2006 2008 2010,2012,2014 2016 2018 2020,2022,2024,2026,2028,2030,2032,2034,2036 2038,2040,
2042, 2044 2046 2048, 2050, 2052 2054, 2056, 2058, 2060,2062,2064, 2066, 2068, 2070, 2072 2074, 2076 2078, 2080, 2082, 2084, 2086, 2088, 2090, 209?, 2094, 2096 2098 2100 2102 2104 2106,2108,2110,2112 2114 2116 2118,2120,2122,2124, 2126, 2128,2130 2132 2134 2136 2138 2140,2142,2144,2146,2148,2150,2152,2154, 2156, 2158 2360, 2162, 2164, 2166 2168, 2170, 2172, 2174 2176, 2178 2180, 2182, 2184, 2186, 2188, 2190, 2192 2194, 2196 2198, 2200, 2202 2204, 2206, 2208, 2210, 2212, 2214, 2216 2218, 2220, 2222, 2224 2226,2228 2230,
2232, 2234, 2236, 2238, 2240, 2242, 2244, 2246, 2248, 2250 2252, 2254, 2256, 2258, 2260, 2262, 2264, 2266 2268, 2270, 2272, 2274, 2276, 2278, 2280, 2282 2284, 2286 2288 2290, 2292, 2294 2296 2298 2300 2302, 2304, 2306, 2308, 2310, 2312, 2314, 2316, 2318, 2320, 2322 2324 2326, 2328, 2330, 2332 2334, 2336, 2338, 2340, 2342, 2344, 2346, 2348 2350 2352 2354 2356, 2358,2360, 2362, 2364, 2366 2368, 2370, 2372, 2374, 2376, 2378, 2380 2382, 2384,2386, 2388,2390, 2392, 2394, 2396, 2398, 2400, 2402,2404, 2406, 2408, 2410, 2432, 2414 2416, 2438 2420,
2422, 2424, 2426, 2428, 2430 2432, 2434, 2436, 2438 2440 2442, 2444 2446 2448 2450 2452 2454, 2456, 2458,
84-

WO 2005/111066PCT/IB2005/001775
2460, 2462, 2464 2466, 2468, 2470, 2472, 2474, 2476, 2478, 2480, 2482, 2484, 2486, 2488, 2490, 2492,2494, 2496,
2498, 2500, 2502, 2504, 2506, 2508, 2510, 2512, 2514, 2516, 2518, 2520 2522 2524,2526, 2528, 2530, 2532, 2534,'
2536, 2538, 2540 2542, 2544, 2546, 2548, 2550, 2552 2554, 2556, 2558,2560 2562 2564, 2566, 2568,2570 2572,
2574, 2576, 2578 2580, 2582, 2584, 2586 2588, 2590, 2592, 2594, 2596,2598, 2600 2602, 2604, 2606,2608, 2610,
2612, 2614, 2616 2618, 2620, 2622, 2624, 2626, 2628, 2630, 2632, 2634, 2636, 2638, 2640, 2642 2644,2646, 2648,
2650, 2652, 2654 2656, 2658, 2660 2662, 2664, 2666, 2668, 2670, 2672 2674,2676 2678 2680, 2682,2684, 2686, 2688, 2690, 2692, 2694, 2696 2G98, 2700, 2702, 2704, 2706, 2708, 2710,2712, 2714, 2716, 2718, 2720 2722, 2724, 2726, 2728, 2730 2732, 2734, 2736, 2738, 2740, 2742, 2744, 2746, 2748,2750, 2752,2754, 2756, 2758, 2760, 2762, 2764 2766, 2768 2770, 2772, 2774, 2776, 2778, 2780, 2782,2784, 2786, 2788, 2790, 2792, 2794,2796,2798, 2800
2801 2804,2806 2*08, 2810, 2812, 2814, 2816, 2818, 2820, 2822, 2824 2826 2828 2830, 2832,2834, 2836 2838
2840, 2842, 2844 2846, 2848, 2850, 2852, 2854 2856, 2858, 2860, 2862,2864, 2866,2868, 2870, 2872, 2874, 2876 2878 2880, 2882, 2884, 2886, 2888, 2890, 2892, 2894, 2896, 2898, 2900, 2902,2904,2906, 290S, 2910,2912, 2914, 2916 2918, 2920, 2922, 2924, 2926, 2928, 2930, 2932, 2934, 2936, 2938, 2940, 2942, 2944 2946 2948, 2950, 2952 2954 2956 2958, 2960, 2962, 2964, 2966 2968 2970 2972 2974 2976 2978 2980 2982 2984 2986,2988 2990
2992, 2994, 2996, 2998, 3000, 3002, 3004, 3006, 3008 3010 3012, 3014, 3016, 3018, 3020, 3022, 3024,3026, 3028,
3030, 3032, 3034, 3036, 3038, 3040, 3042, 3044, 3046, 3048, 3050, 3052, 3054, 3056, 3058, 3060, 3062, 3064, 3066, 3068, 3070, 3072, 3074, 3076, 3078 3080 3082, 3084 3086, 3088, 3090 3092, 3094 3096, 3098, 3100, 3102, 3104 3106, 3108,3110, 3112 3114 3116, 3118, 3120, 3122, 3124 3126, 3128, 3130, 3132 3134, 3136, 3138, 3140, 3142, 3144, 3146,3148 3150 3152 3154 3i56, 3158,3160, 3162, 3164, 3166, 3168, 3170, 3172, 3174, 3176, 3178 3180,
3182, 3184,3186, 3188, 3190, 3192, 3194, 3196, 3198, 3200, 3202, 3204,3206, 3208, 3210, 3212, 3214, 3216, 3218,
3220, 3222,3224, 3226, 3228, 3230, 3232,3234, 3236 3238, 3240,3242 3244 3246, 3248, 3250, 3252,3254 3256 3258, 3260, 3262, 3264, 3266, 3268, 3270, 3272, 3274, 3276, 3278, 3280, 3282, 3284 3286,3288, 3290, 3292 3294 3296, 3298, 3300, 3302, 3304, 3306, 3308, 3310, 3312, 3314, 3316, 3318, 3320, 3322, 3324, 3326, 3328, 3330, 3332, 3334, 3336,3338, 3340, 3342, 3344, 3346, 3348, 3350, 3352, 3354, 3356, 3358,3360, 3362, 3364, 3366 3368, 3370,
3372, 3374 3376, 3378, 3380 3382 3384, 3386, 3388, 3390 3392, 3394, 3396,3398, 3400, 3402, 3404,3406, 3408,
3410,3412,3414,3416 3418 3420 3422 3424,3426 3428 3430 3432,3434 3436,3438,3440,3442,3444,3446, 3448, 3450, 3452, 3454 3456, 3458, 3460, 3462, 3464, 3466, 3468, 3470, 3472,3474, 3476, 3478, 3480, 3482, 3484, 3486, 34SS, 3490, 3492, 3494, 3496 3498,3500,3502 3504 3506 3508,3510,3512 3514 3516,3518,3520,3522, 3524, 3526, 3528, 3530, 3532, 3534 3536, 3538, 3540, 3542 3544 3546, 3548 3550, 3552 3554, 3556 3558 3560
3562,3564,3566 3568, 3570 3572, 3574, 3576, 3578, 3580, 3582, 3584, 3586, 3588, 3590, 3592, 3594, 3596, 3598,
3600, 3602, 3604, 3606, 3608, 3610, 3612, 3614, 3616, 3618, 3620, 3622, 3624, 3626, 3628, 3630, 3632, 3634, 3636, 3638, 3640, 3642 3644 3646, 3648, 3650 3652, 3654, 3656 3658 3660 3662, 3664, 3666 3668 3670, 3672, 3674, 3676 3678 3680, 3682 3684 3686, 3688, 3690, 3692 3694 3696, 3698, 3700, 3702, 3704, 3706, 3708, 3710, 3712, 3714,3716,3718,3720, 3722 3724, 3726, 3728, 3730, 3732, 3734, 3736, 3738, 3740, 3742, 3744, 3746,3748, 3750,
3752, 3754,3756, 3758, 3760, 3762,3764, 3766, 3768, 3770, 3772, 3774, 3776, 3778, 3780, 3782, 3784, 3786, 3788,
3790, 3792, 3794, 3796, 3798 3800, 3802,3804 3806 3808, 3810 3812 3814, 38J6 3818, 3820, 3822, 3824, 3826, 3828 3830 3832 3834 3836 3838, 3840 3842 3844 3846 3848, 3850 3852 3854,3856 3858, 3860 3862, 3864 3866 3868 3870 3872 3874 3876 3878 3880 3882, 3884 3886 3888, 3890, 3892 3894, 3896, 3898, 3900, 3902, 3904, 3906, 3908 3910, 3912 3914, 3916, 3918, 3920, 3922, 3924, 3926,3928, 3930, 3932 3934, 3936 3938, 3940,
3942, 3944,3946,3948, 3950, 3952, 3954 3956, 3958, 3960 3962, 3964, 3966, 3968 3970, 3972, 3974, 3976 3978
-85-

WO 2005/111066PCT/IB2005/001775
3980, 3982, 3984, 3986, 3988, 3990, 3092, 3994, 3996, 3998, 4000, 4002,4004, 4006, 4008,4010, 4012, 4014, 4016,
4018, 4020, 4022, 4024, 4026, 4028, 4030, 4032, 4034, 4036, 4038, 4040, 4042, 4044, 4046, 4048, 4050, 4052, 4054,
4056, 4058, 4060, 4062, 4064, 4066, 4068,4070, 4072, 4074, 4076, 4078, 4080, 4082, 4084, 4086, 4088, 4090, 4092
4094, 4096, 4098, 4100, 4102, 4104, 4106, 4108, 4110, 4112, 4114 4116, 4118, 4120, 4122, 4124, 4126, 4128, 4130,
4132 4134, 4136, 4138, 4140, 4142, 4144, 4146, 4148, 4150, 4152, 4154,4156, 4158,4160, 4162, 4164, 4166, 4168
4170, 4172, 4174, 4176, 4178, 4180 4182, 4184, 4186 4188, 4190, 4192 4194,4196 4198, 4200, 4202, 4204, 4206 4208, 4210, 4212 4214 4216, 4218 4220,4222 4224, 4226, 4228, 4230, 4232,4234, 4236,4238, 4240, 4242, 4244, 4246, 4248, 4250, 4252, 4254, 4256, 4258 4260, 4262,4264, 4266, 4268, 4270, 4272, 4274, 4276, 4278, 4280, 4282, 4284, 4286 4288, 4290, 4292, 4294, 4296, 4298, 4300, 4302, 4304, 4306, 4308, 4310, 4312, 4314, 4316, 4318, 4320,
4322, 4324, 4326, 4328,4330, 4332, 4334, 4336, 4338, 4340, 4342, 4344, 4346,4348 4350, 4352, 4354, 4356, 4358,
4360, 4362, 4364,4366,4368, 4370, 4372,4374 4376 4378 4380 4382,4384, 4386, 4388,4390, 4392, 4394, 4396, 4398, 4400, 4402 4404,4406 4408, 4410 4412, 4414, 4416, 4418, 4420, 4422,4424, 4426, 4428, 4430, 4432, 4434, 4436, 4438, 4440, 4442, 4444, 4446, 4448, 4450, 4452, 4454, 4456, 4458, 4460, 4462, 4464, 4466, 4468 4470 4472, 4474,4476 4478 4480 4482,4484,4486,4488,4490 4492 4494 4496 4498 4500 4502 4504 4506 4508,4510
4512 4514 4516 4518 4520 4522 4524,4526 4528,4530,4532 4534 4536 4538 4540,4542,4544,4546,4548,
45^0 4552 4554 4556, 4558, 4560, 4562, 4564, 4566, 4568, 4570, 4572, 4574, 4576, 4578, 4580, 4582, 4584 4586, 4588, 4590, 4592,4594, 4596, 4598, 4600, 4602, 4604, 4606, 4608, 4610 4612, 4614, 4616, 4618, 4620, 4622, 4624, 4626, 4628, 4630,4632, 4634, 4636, 46^8,4640 4642, 4644, 4646, 4648, 4650, 4652, 4654, 4656, 4658, 4660, 4662, 4664, 4666, 4668,4670, 4672 4674, 4676 4678 4680, 4682, 4684 4686, 4688, 4690, 4692, 4694, 4696, 4698, 4700,
4702, 4704, 4706, 4708, 4710, 4712, 4714, 4716, 4718, 4720 4722, 4724, 4726, 4728, 4730, 4732, 4734, 4736 4738,
4740, 4742, 4744, 4746, 4748, 4750, 4752, 4754, 4756, 4758, 4760, 4762, 4764, 4766, 4768, 4770 4772, 4774, 4776, 4778 4780 4782 4784 4786, 4788 4790, 4792, 4794, 4796, 4798, 4800, 4802, 4804, 4806, 4808, 4810, 4812 4814, 4816 4818 4820, 4822, 4824, 4826, 4S28, 4830, 4832, 4834, 4836, 4838, 4S40, 4842, 4844, 4846, 4848, 4850 4852 4854, 4856, 4858, 4860, 4862, 4864, 4866, 4868, 4870, 4872, 4874, 4876, 4878, 4880, 4882, 4884 4886,4888 4890
4892,4894,4896,4898,4900,4902,4904 4906 4908 4910 4912 4914,4916 4918,4920,4922,4924 4926 4928
4930, 4932, 4934, 4936, 4938, 4940 4942, 4944, 4946, 4948, 4950 4952 49D4 4956, 4958 4960, 4962, 4964, 4966 4968, 4970, 4972 4974, 4976, 4978, 4980, 4982, 4984, 4986, 4988, 4990, 4992 4994, 4996, 4998,5000, 5002 5004, 5006, 5008, 5010, 5012, 5014, 5016, 5018, 5020, 5022, 5024, 3026 5028, 5030, 5032, 5034 5036, 5038, 5040, 5042, 5044 5046, 5048 5050 5052 5054, 5056, 5058 5060, 5062 5064 5066 5068, 5070 5072, 5074, 5076 5078, 5080,
5088,5089,5090,5091 5092,5093,5094 & 5095
4The polypeptidc of claim 3, wherein the fragment comprises a T-cell or a B-cell epitope from the SEQ ID NO amino acid
sequence
5 Antibody that binds to the polypeptidc of any preceding claim
6 Antibody of claim 5, wherein the antibodv is a monoclonal antibody
7 Nucleic acid comprising an nucleotide sequence that has at least 75% sequence identity to one or more of SEQ ID NOS 1565 1569, 1573, b77 1 3,5,7,9,11 13 15 17 19,21,23,25,27,29,31 33,35,37,39,41 43,45,47,49,51,53, 55,57,59,61,63,65,67 69,71,73 75,77,79 81,83 85,87,89 91,93,95 97 99, 101, 103,105, 107,109, 111 113, 115, 117, 119, 121, 123, 125, 127, 129 131 133, 135, 137, 139, 141, 143, 145, 147, 149 151,153 155 157 159 161, 163,165,167 169 171,173 i75 177 179 181,183 185 187 189 191,193 195 197, 199,201,203 205,207 209,
-86-

WO 2005/111066PCT/IB2005/001775
211,213,215,217,219,221,223,225,227, 229,231,233,235,237,239,241,243,245, 247,249,251, 253,255,257,
259 261,263,265,267,269,271,273,275, 277,279,281,283,285,287, 289,291 293 295 297 299,301 303, 305,
307,309,311,313,315 317,319,321,323,325,327 329, 331,333, 335,337,339,341,343,345, 347,349, 351, 353,
355,357,359,361,363,365,367,369, 371,373,375,377, 379,381,383,385,387,389,391,393, 395,397,399, 401,
403,405,407,409,411,413,415,417,419,421,423, 425,427,429,431,433,435,437,439,441, 443,445 447, 449
451,453, 455,457 459,461,463,465,467 469,471,473,475,477,479 481,483,485,487,489 491,493,495, 497, 499,501, 503,505,507,509, 511, 513, 515, 517,519, 521, 523, 525, 527, 529,531,533, 535, 537, 539,541,543, 545, 547,549,551,553,555,557,559, 561, 563, 565,567, 569,571, 573,575, 577,579, 581,581, 585, 587, 589, 591, 593, 595,597,599,601,603,605,607, 609, 611,613,615, 617, 619, 621,623, 625 627, 629,631,633, 635, 637, 639, 641,
643,645, 647,649,651,653,655, 657,659,661, 663 665,667, 669,671, 673,675,677,679,681, 683 685, 687, 689,
691,693, 695,697,699 701,703,705 707,709,711, 713,715,717,719,721, 723,725,727,729, 731,733,735,737, 739,741,743,745,747,749,751, 753, 755,757,759, 761,763,765,767,769, 771,773,775,777 779, 781,783, 785, 787,789,791,793,795, 797,799, 801, 803,805 807, 809, 811, 813, 815 817, 819, 821, 823, 825, 827, 829, 831,833, 835, 837, 839, 841, 843,845, 847, 849, 851,853 855 857, 859, 861,863 865 867, 869, 871, 873, 875 877, 879,881,
883, 885, 887,889, 891,893, 895, 897,899,901,903, 905,907,909,911, 913,915, 917,919,921, 923,925, 927,929,
931, 933, 935, 937, 939, 941, 943, 945, 947, 949, 951, 953, 955, 957, 959, 961 963, 965 967, 969, 971 973 975, 977 979, 981, 983, 985, 987 989, 991, 993, 995, 997, 999, 1001, 1003, 1005, 1007, 1009, 1011, 1013 1015 1017, 1019, 1021, 1023, 1025, 1027, 1029, 1031,1033, 1035,1037, 1039,1041,1043, 1045,1047,1049, 1051, 1053, 1055,1057, 1059, 1061, 1063, 1065, 1067, 1069, 1071, 1073, 1075, 1077, 1079, 1081, 1083, 1085, 1087, 1089, 1091, 1093, 1095,
1097, 1099, 1101, 1103, 1105, 1107, 1109, 1111,1113, 1115 1117,1119, 1121,1123,1125, 1127 1129, 1131, 1133,
1135,1137,1139,1141 1143 1145,1147 1149,1151 1153,1155,1157 1159,1161 1163 1165,1167 1169 1171 1173, 1175, 1177 3179, 1181, 1183, 1185, 1187, 1189, 1191, 1193, 1195, 1197, 1199, 1201, 1203, 1205, 1207, 1209, 1211, 1213, 1215 1217, 1219, 1221, 1223, 1225, 1227, 1229, 1231, 1233, 1235, 1237, 1239, 1241, 1243, 1245, 1247, 1249, 1251,1253 1255 1257 1259, 1261, 1263 1265, 1267, 1269, 1271, 1273, 1275, 1277, 1279, 1281, 1283 1285
1287 1289 1291, 1293, 1295, 1297 1299, 1301 1303, 1305, 1307 1309 1311 1313 1315, 1317, 1319, 1321, 1323,
1325, 1327, 1329, 1331, 1333, 1335, H37, 1339, 1343, 1343, 1345, 1347, 1349, 1351, 1353, 1355, 1357, 1359, 1361, 1363, 1365,1367,1369, 1373, 1373, 1375, 1377, 1379, 1381, 1383,1385,1387, 1389,1391, 1393, 1395, 1397, 1399, 1401,1403,1405, 1407, 1409, 141], 1413,3415, 1417, 1419, 1421 1423 1425, 1427,1429, 1431,1433 1435, 1437, 3439, 1441, 1443, 1445, 1447, 1449, 1451, 1453, 1455, 1457, 1459, 1461, 1463, 1465, 1467, 1469, 1471, 1473, 1475,
1477, 1479, 3481, 1483, 1485, 1487/1489,1491, 1493, 1495, 1497, 1499, 1501, 1503, 1505, 1507, 1509, 1511, 1513,
1515, 1517, 1519, 3521, 1523, 1525, 1527, 1529, 1531 3533,1535, 1537, 1539, 3541 1543 1545, 3547, 3549, 1551, 1553, 1555,1557, 1559, 1561 1563 1565 1567, 1569, 1571 1573 1575 1577 1579 1581, 1583 1585 1587 1589 1591, 1593,1595, 1597, 1599,1601, 1603,1605, 1607, 3609, 1611, 1613, 1615, 1617, 1619, 1621, 1623 1625,1627, 1629 1631 1633, 1635, 1637, 1639, 1641, 1643, 1645, 1647, 1649, 1651, 1653, 1655, 1657, 1659, 1661, 1663, 1665
1667, 1669, 1671, 1673, 3675, 1677, 1679, 1681, 1683, 1685, 1687 1689 1691, 1693, 1695, 1697 1699, 1701, 1703,
1705 1707 1709 1711 1713,1715 1717 1719, 1721, 1723, 3725 1727 1729 1731 3733 1735, 1737,1739,1741, 1743, 1745 1747 1749, 1751, 1753, 1755, 1757, 1759, 1761, 1763, 1765 1767, 1769, 1773, 1773, 1775, 1777, 1779 1781, 1783,1785 1787, 1789, 1791, 1793, 1795, 1797, 1799, 1801, 1803,3805, 1807, 1809, 1811 1813,1815, 1817, 1839, 1821, 1823, 1825, 1827, 1829,1831, 1833, 3835, 1837 1839, 1841, 1843, 1845, 1847, 1849, 1851, 1853, 1855,
1857 1859 3861 1863, 1865 1867 1869 1871, 1873 1875 1877, 1879, 1881 1883 1885 1887 1889, 1891, 1893,
-87-

WO 2005/111066PCT/IB2005/001775
1895 1897,1899 1901, 1903, 1905, 1907,1909,1911, 1913, 1915, 1917, 1919, 1921, 1923,1925, 1927,1929,1931,
1933, 1935, 1937, 1939, 1941, 1943, 1945, 1947, 1949, 1951, 1953, 1955, 1957, 1959, 1961, 1963 1965, 1967, 1969,
1971,1973,1975, 1977, 1979, 1981, 1983,1985,1987,3989 1991, 1993,1995,1997 1999 2001, 2003, 2005 2007
2009,2011, 2013, 2015, 2017, 2019,2021,2023, 2025, 2027, 2029, 2031, 2033, 2035, 2037, 2039, 2041, 2043, 2045,
2047, 2049, 2051,2053,2055, 2057,2059,2061, 2063, 2065, 2067,2069, 2071, 2073, 2075, 2077, 2079, 2081, 20S3
2085 2087,2089,2091,2093,2095,2097,2099,2101,2103 2105 2107 2109 2111,2313,2115,2117 2119,2121, 2123, 2125, 2127, 2129, 2131, 2133,2135, 2137,2139, 2141, 2143, 2145, 2147 2149, 2151, 2153, 2155,2157, 2159, 2161, 2163,2165, 2167, 2169, 2171,2173, 2175, 2177, 2179 2181, 2183, 2185 2187, 21S9, 2191, 2193, 2195, 2197, 2199 2201 2203 2205, 2207, 2209, 2211, 2213, 2215, 2217, 2219, 2221, 2223, 2225, 2227, 2229 2231, 2233, 2235,
2237, 2239,2241,2243, 2245, 2247,2249,2251, 2253, 2255, 2257, 2259,2261, 2263, 2265, 2267, 2269, 2271 2273
2275 2277,2279 2281, 2283, 2285, 2787, 2289, 2291, 2293 2295 2297, 2299, 2301, 2303,2305, 2307, 2309, 2311, 2313, 2315,2317, 2319,2321, 2323 2325, 2327, 2329, 2331, 2333,2335, 2337, 2339, 2341, 2343, 2345, 2347, 2349, 2351, 2353,2355, 2357, 2359, 2361, 2363, 2365, 2367, 2369, 2371, 2373, 2375, 2377,2379, 2381, 2383, 2385, 2387 2389,2391,2393,2395,2397,2399,2401,2403 2405 2407,2409 2411 2413 2415 2417 2419 2421 2423 2425
2427, 2429 2431 2433 2435 2437, 2439,2441, 2443, 2445, 2447, 2449, 2451, 2453, 2455, 2457, 2459,2461 2463
2465, 2467, 2469 2471, 2473, 2475,2477 2479 2481 2483, 2485, 2487, 2489, 2491, 2493, 2495, 2497, 2499, 2501, 2503, 2505, 2507, 2509, 2511, 2533, 2515, 2517, 2519, 2521, 2523, 2525, 2527, 2529, 2531, 2533, 2535, 2537, 2539, 2541 2543, 2545, 2547, 2549, 2551, 2553, 2555 2557, 2559 2561, 2563, 2565, 2567, 2569, 2571, 2573, 2575 2577, 2579, 2581, 2583, 2585, 2587, 2589, 2591, 2593, 2595 2597, 2599 2601 2603,2605 2607, 2609, 2611, 2613,2615,
2617, 2619, 2621, 2623, 2625, 2627, 2629, 2631,2633, 2635, 2637, 2639, 2641, 2643, 2645, 2647, 2649, 2651, 2653,
2655,2657,2659,2661,2663,2665,2667,2669,2671,2673,2675,2677 2679,2681 2683,2685 2687 2689 2691 2693,2695 2697,2699 2701,2703 2705 2707,2709 2711,2713 2715,2717 2719,2721,2723,2725,2727,2729, 2731, 2733 2735, 2737 2739, 2743 2743, 2745 2747, 2749, 2751, 2753, 2755, 2757, 2759, 2761, 2763, 2765, 2767, 2769, 2771, 2773, 2775 2777, 2779, 2781 2783, 2785, 2787, 2789, 2791, 2793, 2795, 2797, 2799 2801, 2803 2805,
2807,2809,2811,2813,2815,2817,2819,2821,2823,2825 2827,2829 2831 2833 2835 2837,2839 2841 2843
2845, 2847, 2849, 2851, 2853, 2855, 2857, 28D9, 2861, 2863, 2865, 2867, 2869 2871, 2873, 2875, 2877 2879, 2881 2883, 2885 2887, 2889, 2891, 2893, 2895, 2897, 2899, 2901, 2903, 2905, 2907, 2909 2911, 2913, 2915, 2917, 2919, 2921, 2923, 2925, 2927, 2929, 2%\, 2933, 2935, 2937, 2939, 2941, 2943, 2945, 2947 2949, 2951, 2953 29:>5, 2957, 2959,2961,2963,2965,2967,2969,2971 2973 2975 2977,2979 2981,2983,2985,2987 2989,2991,2993 2995,
2997, 2999,3001,3003,3005, 3007, 3009,3011,3013, 3015 3017 3019,3021,3023 3025, 3027, 3029, 3031,3033,
3035, 3037,3039, 3041 ->043,3045, 3047,3049,3051, 3053, 3055, 3057, 3059, 3061, 3063,3065, 3067, 3069, 3071, 3073,3075,3077 3079, 3081, 3083, 3085, 3087,3089, 3091, 3093, 3095, 3097, 3099, 3101, 3103 3105, 3107 3109 3111,3113 3115 3117 3119,3121,3123,3125,3127 3129,3131,3133,3135 3137 3139 3141,3143,3145,3147 3149 3351,3153,3155,3157,3159,316! 3163 3165 3167,3169,3171 3173,3175,3177,3179 3181,3183 318:.,
3187, 3189, 3191,3193, 3195,3197,3199,3201, 3203,3205, 3207, 3209, 3211,3213, 3215,3217, 3219,3221,3223,
3225, 3227, 3229, 3231, 3233, 3235, 3237, 3239, 3241, 3243, 3245, 3247, 3249, 3251, 3253, 3255 3257, 3259 3261, 3263,3265 3267,3269 3271,3273 3275,3277,3279 328! 3283 3285,3287,3289,3291,3293,3295,3297,3299, 3301 3303,3305,3307 3309,3311,3313 3315,3317,3319 3321 3323 3325 3327,3329,3331,3333 3335, 3337, 3339,3341,3343,3345,3347,3349,3351,3353 3355,3357,3359 3361,3363,3365 3367,3369 3371 3373,337:.,
3377 3379 3381 3383 3385, 3387, 33S9, 3391, 3393 3395,3397,3399 3401,3403 3405,3407 3409 3411 3413

WO 2005/111066PCT/IB2005/001775
3415,3417, 3419, 3421, 3423,3425,3427, 3429,3431, 3433, 3435,3437, 3439,3441, 3443,3445, 3447, 3449 3451,
3453,3455,3457,3459,3461,3463,3465,3467,3469,3471 3473 3475,3477,3479,3481,3483 3485 3487 3489,
3491, 3493, 3495,3497, 3499, 3501, 3503 3505,3507, 3509 3511,3513, 3515, 3517,3519, 3521, 3523, 3525, 3527,
3529, 3531,3533, 3535, 3537, 3539, 3541, 3543 3545, 3547, 3549,3551, 3553,3555, 3557, 3559, 3561, 3563, 3565,
3567,3569,3571,3573,3575,3577,3579,3581,3583,3585,3587,3589 3591 3593,3595,3597 3599 3601 3603,
3605, 3607, 3609, 3611, 3613, 3615, 3617, 3619,3621 3623, 3625, 3627, 3629, 3631, 3633, 3635, 3637, 3639 3641, 3643,3645, 3647,3649, 3651, 3653,3655,3657,3659, 3661, 3663, 3665, 3667,3669, 3671, 3673,3675, 3677, 3679, 3681, 3683, 3685,3687, 3689, 3691,3693,3695,3697, 3699, 3701, 3703, 3705, 3707, 3709, 3711, 3713, 3715, 3717, 3719, 3721, 3723, 3725, 3727, 3729, 3731, 3733, 3735 3737, 3739, 3741, 3743, 3745, 3747, 3749, 3751, 3753, 3755,
3757,3759,3761, 3763, 3765, 3767, 3769, 3771, 3773, 3775, 3777 3779, 3781, 3783, 3785, 3787, 3789 3791 3793
3795 3797,3799 3801 3803,3805,3807 3809,3811,3813 3815,3817 3819,3821,3823,3825,3827,3829 3831 3833, 3835 3837, 3839, 3841, 3843, 3845,3847,3849, 3851, 3853, 3855, 3S:>7,3859, 3861, 3863, 3865, 3867, 3869, 3871, 3873, 3875,3877, 3879,3881,3883, 3885,3887, 3889, 3891, 3893,3895,3897, 3899 3901 3903, 3905 3907, 3909,3911 3913,3915,3917,3919,3921 3923 3925 3927,3929,3931,3933,3935 3937,3939 3941,3943,3945,
3947 3949 3951, 3953, 3955, 3957, 3959, 3961, 3963, 3965, 3967, 3969 3971, 3973, 3975, 3977, 3979, 3981 3983,
3985, 3987,3989 3991 3993 3995, 3997, 3999, 4001, 4003, 4005, 4007, 4009, 4011, 4013, 4015, 4017, 4019, 4021, 4023, 4025, 4027, 4"029, 4031, 4033, 4015 4037, 4039, 4041, 4043, 4045 4047, 4049, 4051, 4053 4055 4057 4059, 4061, 4063,4065, 4067, 4069 4071, 40/3, 4075, 4077, 4079 408!, 4083, 4085, 4087, 4089 4091, 4093 4095, 4097, 4099,4101,4103,4105 4107 4109 4111,4113 41b, 4117, 4119, 4121, 4123, 4125, 4127, 4129, 4L31, 4133, 4135,
4137, 4139, 4141 4143, 4145, 4147, 4149 4151, 4153, 4155, 4157, 4159, 4161, 4163, 4165, 4167 4169 4171, 4173
4175,4177,4179,4181,4183 4185,4187,4189,4191,4193 4195,4197,4199 4201,4203 4205 4207 4209 4211 4213, 4215, 4217 4219, 4221, 4223, 4225 4227, 4229, 4231, 4233,4235, 4237, 4239 4241, 4243 4245, 4247, 4249, 4251, 42>3 4255, 42:>7, 4259, 4261, 4263, 4265, 4267, 4269, 4271, 4273, 4275, 4277 4279, 4281, 4283, 4285, 4287, 4289, 4291, 4293 4295 4297 4299, 4301, 4303, 4305, 4307, 4309, 4311 4313 4315 4317, 4319, 4321, 4323, 4325,
4327, 4329, 4331 4333, 4333 4337 4339, 4341, 4343 4345, 4347, 4349, 4351, 4353, 4355, 4357, 4359, 4361 4363
4365,4367,4369 4371 4373 4375 4377,4379,4381 4383 4385,4387,4389,4391 4393,4395,4397,4399,4401, 4403 4405, 4407, 4409, 4411, 4413, 4415, 4417, 4419, 4421, 4423, 4425, 4427, 4429 4431, 4433, 4435, 4437, 4439 4441, 4443, 4445, 4447, 4449, 4451, 4453, 4455, 4457,4459 4461 4463 4465 4467 4469, 4471, 4473, 4475,4477 4479 4481,4483,4485 4487,4489 4491,4493,4495 4497 4499 4501 4503,4505,4507,4509,4511,4513,4515,
4517,4519 4521 4523 4525 4527 4529 4531 4533 4535 4537 4539 4541,4543,4545,4547,4549,4551,4553,
4555 4557 4559, 4561, 4563, 4565, 4567, 4569, 4571, 4573, 4575, 4577, 4579, 4581, 4583, 4585, 4587, 4589, 4591, 4593 4595,4597,4599,4601,4603,4605,4607,4609,4611,4613,4615,4617 4619 4621 4623 4625 4627 4629 4631 4633, 4635, 4637, 4639, 4641, 4643 4643 4647 4649 4651, 4653,4655, 4657,4659, 4661, 4663,4665, 4667, 4669, 4671,4673, 4675 4677, 4679, 4681, 4683, 4685, 4687 4689, 4691 4693, 469> 4697, 4699, 4703, 4703 4705,
4707 4709, 4711, 4713, 4715, 4717 4719 4721, 4723, 4725, 4727, 4729, 4731, 4733, 4735, 4737 4739, 4741, 4743,
4745, 4747, 4749, 4751, 4753, 4755, 4757, 4759, 4761, 4763, 4765, 4767,4769, 4771 4773, 4775 4777 4779, 4781, 4783 4785 4787 4789 4791,4793 4795,4797,4799 4801 4803,4805,4807 4809,4811,4813 4815 4817,4819 4821 4823 4825,4827,4829 4831,4833 4835,4837,4839,4841 4843 4845,4847 4849,4851,4853,4855,4857, 4859, 4861, 4863 4865, 4867,4869, 4871, 4873 4875, 4877, 4879, 4881, 4883, 4885, 4887 4889, 4891 4893, 4895,
4897, 4899, 4901, 4903, 4905, 4907, 4909 4911, 4913, 4915, 4917, 4919 4921, 4923 4925, 4927, 4929, 4931, 4933
-89

WO 2005/111066PCT/IB2005/001775
4935, 4937, 4939,4941, 4943, 4945, 4947, 4949,4951, 49D3, 4955, 4957, 4959, 4961, 4963, 4965, 4967, 4969, 4971, 4973, 4975, 4977, 4979, 49S1, 4983, 4985, 4987, 4989, 4991, 4993, 4995, 4997, 4999 5001, 5003 5005, 5007 5009 5011, 5013, 5015 5017, 5019, 5021, 5023, 5025, 5027, 5029, 5031, 5033 5035, 5037, 5039, 5041, 5043, 5045 5047 5049,5051,5053,5055,5057,5059,5061,5063,5065,5067,5069 5071 5073,5075,5077 and 5079
8 Nucleic acid of claim 7, comprising an nucleotide sequence selected from SEQ ID NOS 1,3 5 7 9 11,13 15, 17, 19, 21,23,25,27,29,31,33,35,37,39,41,43,45,47,49,51, 53 55, 57, 59,61, 63,65,67, 6% 71,73, 75,77 79, 81, 83, 85, 87, 89, 91,93,95,97,99,101,303,105,107,109, 111, 113,115 117,119,121,123,125,127,129,131,133,135, 137,139, 141, 143,145,147,149,151 153,155, 157, 159, 161,163, 165,167,169,171,173,175,177,179, 181, 183, 185, 187, 189, 191,193, 195,197, 199,201,203 205,207,209,211, 213,215,217,219 221, 223, 225,227, 229, 231,
233 235,237,239,241,243 245,247,249 251 253 255 257 259,261 263 265 267 269,271,273 275,277,279,
281,283,285 287,289,291,293,295 297,299 301 303 305 307,309 311,313,315,317,319,321,323,325,327, 329,331,333,335,337,339,341,343,345,347,349,351, 353,355, 357,359,361,363,365,367,369,371,373, 375, 377,379,381,383,385,387,389,391,393,395,397,399,401,403,405 407 409,411,413,415,417 419 421 423 425 427,429 433 433 435 437 439 44! 443 445,447 449 451,453 455 457 459 461 463 465,467 469 471
473,475,477 479 481,483,485 487 489 491,493,495,497,499,501, 503, 505, 507,509, 511, 513,515, 517, 519
521,523,525,527, 529,531,533, 535, 537, 539, 541, 543, 545,547,549, 551, 553, 555, 557, 559,561, 563,565 567, 569,571,573, 575, 577, 579, 58i, 583, ^85, 587 589,591, 593,595,597, 599, 601, 603 605, 607, 609 611,613, 615, 617, 619,621, 623,625, 627, 629, 631,633,635, 637, 639, 641 643 645 647, 649, 651, 653, 655,657 659 661 663, 665, 667 669 671, 673 675, 677, 679, 681, 683, 685, 687, 689, 691, 693, 695, 697, 699, 701, 703, 705, 707,709, 711,
713, 715, 717, 719, 721, 723, 725, 727, 729, 731, 733, 735, 737, 739, 741, 743, 745, 747, 749, 751 753 755, 757 759,
761 763,765, 767,769, 771, 773, 775,777,779,781,783, 785, 787,789,791,793,795, 797, 799, 801, 803, 805, 807, 809 811 813,815 817 819,821 823 825,827 829 831,833,835,837,839,84] 843,845,847,849,851,853 855, 857, S59,861, 863, 865,867,869,871,873, 875,877, 879, 881, 883,885, 887, 889, 891, 893, 895, 897,899, 901, 903, 905, 907, 909, 911,913 915,917,919,921,923,925, 927, 929 931, 933, 935, 937 939, 941,943,945,947 949, 951,
9:>3,955, 957,959,961,963,965,967,909,971,973, 975, 977,979, 981, 983, 985 987, 989,991, 993,995, 997, 999,
1001 1003 1005, 1007, 1009, 1011, 1013 1015, 1017, 1019, 1021, 1023, 1025, 1027 1029, 1031, 1033, 1035, 1037, 1039, 1041, 1043, 1045, 1047, 1049, 1051, 1053, 1053, 1057 1059, 1061, 1063, 1065 1067, 1069, 1071, 1073, 1075, 1077,1079,1081 1083,1085,1087 1089,1091,1093 1095 1097,1099 1101 1103,1105,1107,1109 1111,1113, 1115,1117,1119,1121 1123 1125 1127,1129,1131 1133 1135 1137,1139 1141 1143 1145 1147,1149 1151,
1153, Hi5, 1157, 1159, 1161, 1163, 1165, 1167, 1169, 1171, 1173, 1175, 1177, 1179 1181, 1183, 1185, 1187, 1189,
1191 1193, 1195, 1197, 1199, 1201, 1203, 1205,1207, 1209, 1211, 1213, 1215 1217, 1219, 1221 1223 1225 1227, 1229,1231, 1233, 1235, L237, 1239, 1241, 1243, 1243, 1247, 1249, 1251, 1253, 1255 1257, 1259, 1261, 1263, 1265, 1267,1269 1271, 1273 1273 1277,1279 1281,1283,1285 1287 1289, 1291, 1293 1295 1297 1299, 1301, 1303, 1305, 1307, 1309, 1311, 1313, 1315, 1317,1319, 1321, 1323, 1325 1327, 1329, 1331, 1333, 1335, 1337, 1339, 1341,
1343, 1345, 1347, 1349, 1351, 1353, 1355, 1357, 1359, 1361, 1363, 1365, 1367, 1369, 1371, 1373, 1375, 1377, 1379
1381,1383 1385,1387,1389 1391 1393,1395 1397 1399,1401 1403 1405 1407 1409,1411 1413, 1415, 1417, 1419,1421,1423, 1425,1427, 1429 1431 1433 1435, 1437, 1439, 1441, 1443 1445 1447, 1449,1451, 1453 1455, 1457, 1439,1461 1463, 1465, 1467, 1469, 1471, 1473, 1475, 1477, 1479 1481, 1483 1485 1487, 1489 1491, 1493, 1495, 1497, 1499, 1501 1503, 1505, 1507 1509, 1511,1513 1515, 1517, 1519, 1521 1523, 1525, 1527 1529, 1531
1533, 153o, 1537, 1539 1541, 1543, 1545, 1547, 1549, 1551, 1553, 1555 1557 1559 1561 1563 1565 1567, 1569,
-90-

WO 2005/111066PCT/IB2005/001775
1571, 1573, 1575, 15773 1579, 1581, 1583, 1585, 1587, 1589, 1591, 1593, 1595, 1597 1599, 1601, 1603, 1605, 1607,
1609, 1611, 1613, 1615, 1617, 1619, 1621, 1623, 1625 1627 1629, 1631,1633, 1635, 1637, 1639, 1641, 1643, 1645,
1647 1649 1651,1653,1655, 1657,1659 1661,1663, 1665, 1667, 1669, 1671,1673, 1675, 1677, 1679, 1681, 1683,
1685, 3687,1689, 1691, 1693, 1695,1697 1699,1701,1703,1705, 1707, 1709,1711, 1713, 1715, 1717 1719,1721,
1723, 1725, 1727, 1729, 1731, 1733, 1735, 1737, 1739, 1741, 174J, 1745, 1747, 1749, 1751, 1753, 1755, 1757, 1759,
176J, 1763, 1765, 1767, 1769, 1771, 1773, 1775, 1777, 1779,1781, 1783, 1785,1787 1789, 1791, 1793 1795, 1797, 1799, 1801,3803,1805,1807,1809 1811, 1813,1815 1817 1819,1821,1823,1825, 1827,1829, 1831, 1833, 1835, 1837, 1839, 1841 1843, 1845, 1847, 1349, 1851, 1853, 1855, 1857, 1859, 1861, 1863, 1865, 1867, 1869, 1871 1873, 1875, 1877, 1879, 1881, 1883, 1885,18873 1889, 1891, 3893, 1895, 1897, 1899, 1901 1903, 1905, 1907 1909 1911
1913,1915, 1917, 1919,1921 1923, 1925, 1927,1929, 1931,1933, 1935, 1937, 1939,1941, 1943, 1945,1947 1949,
1951 1953 1955 1957 1959, 1961 1963, 1965,1967 1969, 1971,1973, 1975,1977, 1979, 1981, 1983, 1985,1987, 1989,1991,1993,1995,1997, 1999, 2001, 2003, 2005, 2007, 2009, 2011, 2013, 2015, 2017, 2019, 2021, 2023, 2023, 2027, 2029, 2031, 2033, 2035, 2037, 2039, 2041, 2043, 2045, 2047, 2049, 2051, 2053, 2055 2057, 2059, 2061, 2063, 2065 2067,2069,2071,2073 2075 2077 2079 2081 2083,2085 2087 2089 2091 2093,2095 2097,2099 2101
2103, 2103, 2107 2109 2111, 2113, 2115, 2117, 2119, 2121, 2123, 2125, 2127, 2129,2131, 2133, 2135, 2137, 2139,
2141, 2143, 2145, 2147, 2149, 2151, 2153, 2155, 2157, 2159 2161, 2163, 2165, 2167, 2169, 2171, 2173, 2175 2177, 2179, 2181, 2183, 2185, 2187, 2189, 2191, 2193, 2195, 2197, 2199, 2201, 2203, 2205, 2207, 2209, 2211, 2213 22b, 2217, 2219, 2221, 2223, 2225, 2227, 2229, 2231, 2233, 2235, 2237 2239 2241, 2243, 2245, 2247, 2249, 2251 2253, 2255, 2257, 2259, 2261, 2263, 2265, 2267,2269, 2271, 2273, 2275, 2277, 2279, 2281, 2283, 2285 2287, 2289 2291,
2293, 2295, 2297, 2299, 2301, 2303, 2305, 2307, 2309, 2311, 2313, 2315, 2317, 2319, 2321, 2323 2325, 2327, 2329
2331, 2333, 2335,2337, 2339, 2341, 2343, 2345, 2347, 2349, 2351, 2353, 2355, 2357 2359, 2361, 2363 2365,2367, 2369,2371 2373 2375,2377,2379,2381 2383,2385,2387,2389,2391,2393,2395,2397,2399,2401,2403 2405, 2407, 2409, 2411, 2413, 2415, 2417, 2419, 2421, 2423, 2425, 2427, 2429, 2431, 2433, 2435, 2437, 2439, 2441 2443 2445, 2447, 2449, 2451, 2453, 2455, 2457, 2459, 2461, 2463, 2465, 2467 2469 2471 2473 2475, 2477, 2479, 2481,
2483 2485 2487 2489 2491,2493 2495 2497,2499 2501,2303,2305 2507,2309,2511,2313,2515 2517,2519,
2521,2523,2523 2527,2529,2531,2533 2535,2537 2539 2541,2343 2545,2347,2549,2351,2553,2555,2557, 2559, 2561, 2563,2565, 2567, 2569, 2571, 2573, 2575, 2577, 2579, 2581, 2583, 2385, 2587 2589, 2591, 2593, 2595, 2597, 2599, 2601, 2603, 2605, 2607 2609, 261!, 2613, 2615 2617 2619,2621, 2623, 2625, 2627, 2629, 2631, 2633, 2635 2637,2639,2641 2643,2645,2647 2649,2651,2633 2655 2657,2639,2661 2663 2665,2667,2669,2671,
2673, 2675, 2677 2679, 2681, 2683, 2685, 2687, 2689, 269! 2693, 2695, 2697, 2699, 2701, 2703, 2705, 2707, 2709,
2711, 2713, 27(5, 27i7, 2719, 2721, 2723,2725,2727, 2729, 2731, 2733, 2735, 2737, 2739, 2741, 2743, 2745 2747, 2749,2751,2753,2755,2757 2759,2761,2763 2765 2767,2769,2771 2773 2775 2777,2779 2781 2783 2785 2787,2789 2791 2793 2793 2797 2799,2801 2803,2805,2807,2809,2811,2813,2815,2817,2819,2821,2823, 2825 2827,2829,2831 2833,2835 2837,2839,2841 2843,2845,2847,2849 2831,2853,2855,2837,2859,2861,
2863, 2865, 2867, 2869,2871, 2873, 2875, 2877,2879, 2881, 2883, 2885, 2887, 2889, 2891, 2893 2895, 2897, 2899,
2901, 2903, 2905, 2907, 2909, 2911, 2913, 2915, 2917, 2919 2921 2923, 2923, 2927 2929, 2931, 2933, 2935, 2937, 2939,2941 2943 2945,2947 2949,2951,2953 2955,29^7,2959 2961,2963,2965 2967,2969,2971,2973 2975, 2977,2979,2981,2983,2985,2987 2989,2991,2993 2995,2997 2999,3001 3003 3003 3007,3009,3011,3013, 3015 3017,3019,3021 3023 3025, 302/, 3029, 3031, 3033, 3033, 3037, 3039, 3041, 3043 3045 3047,3049,3051,
3053, 3055, 3057, 3059, 3061, 3063, 306\ 3067, 3069 3071, 3073, 3073 3077, 3079 3081 3083 3085 3087 3089
-91

WO 2005/111066PCT/IB2005/001775
3091, 3093, 3095, 3097, 3099, 3101, 3103, 3105, 3107 3109, 3111, 3U3, 3115, 3117, 3119, 3121, 3123, 3125, 3127
3129,3131,3133,3135,3137 3139,3141,3143 3145,3147,3149 3151,3153,3155,3157,3159 3161,3163,3165,
3167,3169, 3171 3173, 3175, 3177 3179, 31S1 3183, 3185, 3187, 3189, 3191,3193, 3193, 3197, 3199, 3201, 3203,
3205, 3207,3209, 3211, 3213, 3215, 3217 3219, 3221, 3223, 3225, 3227, 3229, 3231,3233, 3235 3237,3239 3241,
3243, 3245, 3247,3249, 3251, 3253, 3255 3237,3259, 3261,3263, 3265, 3267 3269 3271 3273 3275,3277, 3279,
32SI, 3283, 3285 3287, 3289 3291, 3293 3295,3297 3299, 3301, 3303,3305, 3307, 3309, 3311, 3313, 3315 3317 3319, 3321,3323 3325, 3327, 3329, 3331,3333, 3335, 3337, 3339,3341,3343, 3345, 3347, 3349, 3351, 3353, 3355, 3357, 3359,3361,3363, 3365, 3367,1369 3371, 3373, 3375,3377, 3379, 3381,3383 338s 3387, 3389, 3391, 3393, 3395, 3397, 3399, 3401, 3403, 3405, 3407 3409, 3411 3413, 3415, 3417, 3419 3421 3423, 3425, 3427, 3429 3431
3433,3435, 3437, 3439, 3441, 3443, -(445,3447, 3449, 3451, 3453,3455, 3457, 3459 3461, 3463, 3465, 3467, 3469
3471, 3473,3475, 3477, 3479, 3481, 3483,3483, 3487, 3489, 3491, 3493, 3493, 3497,3499, 3501, 3503, 3505 3507, 3509, 3511, 3513 3515, 3517, 3519, 3521, 3523, 3523, 35273 3529, 3531 3533, 3535, 3537, 3539, 3541, 3543, 3545, 3547, 3549,3551 3553, 3555, 3557, 3559, 3561, 3563, 3565, 3567, 3569 3571 3573, 3575, 3577, 3579 3581 3583, 3585,3587,3589 3591,3593 3595 3597,3599 3601 3603 3605,3607 3609 3611 3613,3615,3617,3619 3621,
3623, 3625 3627 3629, 3631, 3633, 3635, 3637 3639, 3641, 3643, 3645, 3647 3649, 3651, 3653, 3655, 3657, 3659,
3661 3663 3665,3667,3669,3671,3673,3675,3677,3679,3681,3683 3685,3687,3689,3691 3693,3695 3697 3699 3701, 3703 3705, 3707, 3709, 3711, 3713, 3715 3717, 3719 3721, 3723, 3725 3727, 3729, 3731, 3733, 3735 3737,3739 3741 3743,3745 3747, 3749, 3751, 3753, 3755, 3757,3739, 3761 3763 3765, 3767, 3769, 3771, 3773, 3775, 3777, 3779, 3781, 3783, 3785,3787, 3789, 3791, 3793, 3795, 3797, 3799, 3801 3803, 3805, 3807, 3809, 3811,
3813, 3815, 3817, 3819, 3821, 3823, 3825, 3827, 3829, 3831, 3833, 3835, 3837 3839, 3841, 3843 3845 3847 3849,
3851, 3853,3855, 3857, 3859 3861, 3863, 3865, 3867, 3869, 3871 3873 3875 3877, 3879 3881, 3883,3885 3887 3889 3891 3893 3895,3897,3899 3901,3903,3905 3907 3909,3911 3913,3915 3917 3919,3921,3923,3925, 3927 3929,3931, 3933 3935, 3937, 3939, 3941, 3943, 3945, 3947, 3949, 3951, 3953, 3955, 3957, 3959, 3961, 3963, 3965, 3967, 3969, 3971, 3973, 3975, 3977, 3979, 3981 3983 3985, 3987,3989, 3991, 3993, 3995, 3997, 3999, 4001,
4003,4005 4007,4009 4011 4013 4015 4017 4019,4021 4023 4025,4027 4029,4031,4033 4035,4037,4039,
4041 4043,4045,4047,4049,4051 4053,4055 4057,4059 4061,4063,4065,4067,4069 4071 4073,4075,4077, 4079,4081,4083,4085,4087,4089,4091,4093,4095 4097,4099,4101,4103 4105,4107,4109,4111,4113 4115, 4117,4119,4121,4123,4125,4127,4129,4131 4133,4135,4137 4139,4141 4143,4145 4147 4149,4151 4153 4155 4157, 4159, 4161, 4163, 4165, 4167, 4)69,4171, 4173, 4175, 4177,4179, 4181, 4183, 4185, 4187,4189, 4191,
4193 4195 4197 4199 4201 4203 4205, 4207 4209, 4211, 4213, 4215,4217, 4219, 4221, 4223, 4225,4227,4229
4231, 4233 4235, 4237 4239, 4241, 4^43, 4245, 4247, 4249, 4251, 4253, 4255, 4257, 4259, 4261, 4263, 4265, 4267, 4269, 4271, 4273, 4275, 4277, 4279, 4281, 4283 4285, 4287 4289 4291 4293, 4295 4297, 4299 4301, 4303, 4305 4307,4309,4311,4313 4315,4317 4319,4321,4323,4325 4327,4329,4331 4333,4335 4337,4339,4341,4343, 4345 4347,4349 4351 4353, 4355 4357, 4359 4361, 4363, 4363, 4367, 4369,4371, 4373, 4375, 4377, 4379, 4381,
4383, 4385, 4387, 4389, 4391, 4393, 4395, 4397, 4399, 4401, 4403, 4405, 4407, 4409, 4411, 4413, 4415 4417, 4419,
4421, 4423, 4425, 4427, 4429, 4431, 4433 4435, 4437, 4439, 4441 4443, 4445, 4447, 4449 4451, 4453, 4453 4457, 4459 4461, 4463, 4465, 4467, 4469 4471 4473, 4475 4477 4479, 4481 4483, 4485 4487 4489, 4491, 4493, 4495, 4497 4499,4501 4503 4505 4507 4509 4511,4513 4515 4517 4519,4521,4523,4525 4527,4529,4531,4533, 4535 4537, 4539, 4541, 4543, 4545, 4547, 4549, 4551 4553, 4555, 4557, 4539, 4561, 4563 4565, 4567, 4569, 4571,
4573, 4575, 4577, 4579, 4581, 4583, 4585, 4587 4589, 4591 4593 4595, 4597 4599 4601 4603 4605 4607, 4609
-92-

WO2005/l11066PCT/IB2005/001775
4611, 4613, 4615, 4617, 4619, 4621, 4623, 4625, 4627, 4629, 4631, 4633, 4635, 4637, 4639, 4641, 4643, 4645, 4647,
4649, 4651, 4653, 4655, 4657, 4659, 4661, 4663, 4665, 4667, 4669, 4671, 4673 4675, 4677, 4679, 4681, 4683, 4685,
4687,4689 4691,4693,4695,4697 4699,4701,4703,4705,4707 4709,4711,4713 4715,4717,4719 4721 4723
4725, 4727, 4729,4731, 4733, 4735, 4737, 4739, 4741,4743, 4745 4747, 4749 4751, 4753, 4755, 4757, 4759,4761,
4763, 4765 4767 4769, 4771, 4773, 4775, 4777, 4779, 4781, 4783, 4785, 4787, 4789, 4791, 4793, 4795, 4797, 4799,
4801, 4803, 4805, 4807, 4809, 4811, 4813, 4815, 4817, 4819, 4821, 4823 4825 4827, 4829, 4831, 4833, 4835, 4837,
4839, 4841, 4843, 4845, 4847, 4849, 4851, 4853, 4855,4857, 4859, 4861 4863, 4865, 4867, 4869, 4871,4873, 487J
4877,4879,4881,4883,4885 4887,4889,4891,4893,4895 4897 4899 4901,4903 4905,4907,4909 4911,4913,
4915, 4917, 4919 4921, 4923, 4925, 4927, 4929, 4931,4933, 4935, 4937, 49J9, 4941, 4943, 4945, 4947, 4949, 49M
4953, 4955, 4957,4959, 4961, 4963, 4965, 4967, 4969, 4971, 4973, 4975,4977, 4979, 4981, 49S3, 4985, 4987, 4989,
4991 4993 4995,4997,4999 5001 5003 5005 5007 5009,5011,5013,5015,5017,5019,5021,5023 5025,5027 5029,5031 5033,5035,5037,5039 5041,5043,5045 5047 5049,5051,5053 5055,5057,5059,5061,5063,5065, 5067,5069, 5071, 5073, 5075,5077 and 5079
9 Nucleic acid that can hybridize to the nucleic ac?d of claim 8 under high stringencj conditions
10 Nucleic acid comprising a fragments of 10 or more consecutive nucleotides from one or more of SEQ ID NOS 1563, 1569, 1573, 1577, I, 3, 5, 7, 9, 11,13, b, 17, 19, 21,23,25, 27,29,31, 33, 35,37, 39 41, 43,45 47, 49 51, 53 ;>5, 57, 59,61,63,65,67,69,71,73,75,77,79,81 83 85 87 89,91 93,95,97,99,101 103,105,107,109,111,113,1b, 117,119,121,123,125,127,129,131,133,135,137,139 141,143 145 147,149 151,153, b5, 157,159 161 163 165,167,169,171,173,175,177,179 181,183,185,187,189 191,193,195,197 199,201,203,205,207 209,211,
213,215, 217,219,221, 223,225, 227, 229,231,233,235,237, 239, 241,243, 245 247 249, 2M, 253,255 257 239
261,263, 265,267,269,271,273, 275, 277,279,281,283,285, 287, 289, 291, 293, 293, 297,299, 301,303, 305, 307, 309 311 313,315,317,319 321,323,325,327,329,331,333,335,337,339,341 343,343,347,349,351 353,333, 357,359,361, 363,365,367, 369, 371,373,375,377,379,381,383, 385,387 389 391,393,395,397, 399, 401,403, 405,407,409,411,413,415,417 419 421,423 425,427,429 431 433,435,437 439,441,443,445 447 449,431
453 455 457,459,461,463,465 467 469,471 473 475 477 479 481 483 485 487 489 491,493 495 497,499
501, 503, 505, 507,509, 511, 513, 515,517,519, 521,523, 525, 527, 529,531 533, 533, 537, 539, 341, 543 543, 547, 549, 551, 553, 555, 357, 559, 561, 563, 565, 567, 569, 371, 573, 575, 577, 579 581 583, 585, 587, 589, 591 593, 595, 597 599,601 603 605,607,609,611 613,615,617,619,621,623 625,627 629 631,633,635,637 639,641,643, 645,647 649,651 653 655,657,659,661 663,665,667 669,671,673,675 677 679,681,683 685,687 689,691
693,695, 697,699,701, 703,705, 707,709,711,713,715,737, 719, 721, 723, 725 727,729,731, 733,735 737, 739,
741,743,745,747,749,751,753,755,757 759,761,763,765 767,769 771,773 773,777,779 781 783 785,787 789,791,793,795,797,799,801 803,805,807,809,811,813 815 817,819 821 823,825,827,829,831 833, 83 J, 837,839,841,843,845 847 849 851, 8S3, 855, 857, 859, 861, 863, 865 867,869 871 873 875,877,879 881,883 885 887 889 891,893,895,897,899,901,903,905,907,909 911,913,915 917,919 921,923,925,927 929,931,
933,935,937, 939,941,943,945, 947,949,951,953, 955, 957,959, 961, 963,965 967, 969, 971, 973,975, 977, 979,
981 983 985,987,989 991 993 995 997,999 1001 1003,1005 1007 1009,1011,1013,1015,1017,1019,1021, 1023,1025,1027 1029,1031 1033,103^1037 1039 1041 1043 1045,1047,1049,1051 1053,1055 1037,1059, 1061, 1063, 1065, 1067 1069, 1071, 107', 1075, !077 10^9, 1081 1083, 1085, 1087, 1089 1091, 1093, 1095,1097, 1099,1101,1103,1105,1107,1109 1111,1113,1115 1117, 1! 19, 1121 1123, ! 125, 1127 1129,1131,1133,1133,
-93-

WO2005/111066PCT/IB2005/001775
1137, 1139, 1141, 1143, 1145, 1147, 1149, 1151, 1153, 1155, 1157, 1159, 1161, 1163 1165, 1167, 1169 1171, 1173
1175,1177,1179, 1181 1183 1185, 1187,1189,1191, 1193,1195,1197,1199, 1201, 1203, 1205, 1207,1209,1211,
1213, 1215 1217, 1219, 1221 1223, 1225 1227, 1229, 1231 1233, 1235 1237, 1239, 1241, 1243, 1245, 1247, 1249,
1251, 1253, 1255, 1257 1259, 1261, 1263, 1265, 1267, 1269, 1271, 1273, 1275, 1277, 1279, 1281, 1283, 1285, 1287,
1289, 1291, 1293, 1295, 1297, 1299, 1301, 1303, 1305, 1307, 1309, 1311 1313 1315, 1317, 1319 1321 1323, 1325,
1327 1329,1331, 1333, 1335, 1337, 1339, 1341, 1343, 1345, 1347, 1349, 1351 1353 1355, 1357, 1359, 1361 1363 1365,1367, 1369, 1371, 1373, 1375, 1377 1379 1381 1383,1385,1387,1389,1391,1393, 1395, 1397,1399,1401, 1403, 1405, 1407, 1409 1411, 1433, 1415, 1417,1419, 1421,1423, 1425, 1427, 1429, 1431, 1433, 1435, 1437, 1439, 1441, 1443, 1445, 1447,1449, 1451, 1453, 1455, 1457, 1459, 1461, 1463 1465 1467, 1469, 1471, 1473, 1475 1477,
1479, 1481, 1483, 1485, 1487, 1489, 1491, 1493, 1495 1497 1499, 1501, 1503 1505 1507 1509, 1511, 1513, 15b
1517, 1519 1521,1523 1525, 1527, b29,1531,15333 1535,1537, 1539, 1541,1543, 1545, 1547,1549, 1551, 1553, 1555, 1557, 1559, 1561, 1563, 1565, 1567, 1569, 1571, 1573, 1575, 1577, 1579,1581, 1583, 1585, 1587, 1589 1591, 1593, 1595, 1597, 1599, 1601, 1603, 1605, 1607, 1609, 1611 1613, 1615, 1617, 1619, 1621, 1623 1625, 1627, 1629, 1631, 1633 1635 1637 1639, 1641, 1643, 1645, 1647 1649 1651 1653 1655,1657, 1659, 1661, 1663,1665 1667,
1669, 1671, 1673 1675, 1677, 1679, 1681, 1683, 1685 1687, 1689, 1691, 1693, 1695, 1697, 1699, 1701, 1703 1705
1707, 1709, 1711, 1713, 1715, 1717, 1719, 1721, 1723, 1725, 1727, 1729 1731, 1733, 1735, 1737, 1739, 1741 1743 1745, 1747, 1749, 1751, 1753, 1755, 1757,1759, 1761, [763, 1765, 1767,1769 1771, 1773,1775, 1777 1779, 1781 1783, 1785, 1787 1789 1791 1793, 1795, 1797, 1799 1801, 1803, 1805, 1807 1809, 1811, 1813, 1815, 1817 1819, 1821, 1823, 1825, 1827, 1829, 1831 1833 1835, 1837, 1839, 1841, 1843, 1845, 1847, 1849, 1851 1833, 1855 1857,
1859,186!, 1863,1865, 1867, 1869,18/1, 1873,1875, 1877, 1879, 1881,1883,1885,1S87, 1889 1891, 1893, 1895
1897, 1899, 1901, 1903, 1905, 1907 1909,1911, 1913 1915, 1917, 1919, 1921 1923,1923, 1927 1929, 1931, 1933 1935 i937, 1939 1941, 1943, 1945, 1947, 1949, 1951, 19D3, 1955, 1957, 1959 1961, 1963, 1965 1967,1969, 1971, 1973,1975, 1977, 1979,1981,1983,1985, 1987, 1989, 1991, 1993, 1993, 1997, 1999, 2001, 2003 2005, 2007, 2009 20! I, 2013, 2015, 2017, 2019, 2021, 2023, 2025, 2027 2029 2031, 2033, 2035, 2037 2039, 2041 2043, 2045, 2047,
2049,2051,2053 2035,2057 2059 2061,2063,2065 2067 2069,2071 2073 2073 2077,2079 2081,2083,2085,
2087,2089,2091,2093 2095,2097 2099 2101 2103,2105 2107,2109 2111,2113,2115,2117 2119,2321,2123, 2125, 2127,2129, 2131, 2133, 2135, 2137 2139, 2141, 2143, 2145, 2147, 2149, 2151, 2153, 2155 2157, 2159, 2161, 2163,2165,2167,2169,2171,2173,2175 2177,2179,2181,2183,2185 2187,2189 2191 2193 2195,2197 2199, 2201, 2203, 2205 2207, 2209 2211 2213 2215 2217, 2219, 2221, 2223, 2223, 2227, 2229, 2231, 2233, 2235, 2237,
2239 2241 2243 2245,2247 2249, 22M, 2253 2253 2257,2259,2261 2263,2265,2267,2269,2271,2273,2275,
2277,2279,2281 2283,2285,2287,2289,2291,2293,2295,2297,2299 2301,2303 2305 2307 2309 2311 2313, 2315,2317,2319 2321, 2323, 2325, 2327, 2329,2331, 2333 2335, 2337 2339 2341, 2343, 2345, 2347, 2349, 2351, 2353 2335 2357 2359, 2361, 2363, 236S, 2367, 2369, 2373, 2373, 2375 2377, 2379 2381, 2383 2385, 2387, 2389, 2391, 2393 2395 2397, 2399, 2401, 240;, 2405, 2407, 2409, 2411, 2413 2415, 2417 2419 2421, 2423, 2425 2427,
2429 2431 2433 2435, 2437 2439, 2441, 2443, 2443, 2447, 2449, 2451 2453, 2455, 2457 2459,2461, 2463, 2465,
2467 2469, 2471, 2473, 2473, 2477 2479, 248! 2483 2485, 2487, 2489 2491 2493, 2495, 2497 2499 2501, 2503, 2505,2507 2509,2511 2513,2515,2517 2519 2521,2523 2525,2527 2529 2531 2533,2535 2537,2539,2541, 2543,2545,2547 2549 2551 2553 2555 2557 2559 2561 2563,2565 2567,2569 2571 2573 2575,2577,2579 2581, 2583, 2585, 2587, 2589, 2591, 2393, 2595, 2597, 2599, 2601, 2603, 2605, 2607 2609 2611, 2613,2615, 2617,
2619,2621,2623,2625 2627,2629 2631 2633,2635 2637 2639 2641 2643 2643,2647 2649 2651 2653 2655
-94-

WO 2005/111066PCT/IB2005/001775
2657, 2659, 2661,2663, 2665, 2667, 2669,2671, 2673, 2675, 2677, 2679, 2681, 2683, 2635, 2687 2689, 2691, 2693,
2695, 2697, 2699,2701 2703 2705, 2707, 2709 2713 2713, 2715, 2717, 2719, 2721, 2723, 2725, 2727, 2729, 2731,
2733 2735 2737,2739,2741 2743,2745,2747 2749,2751,2753 2755,2757,27^9 2761,2763,2765,2767 2769
2771, 2773, 2775, 2777, 2779, 2781, 2783,2785,2787, 2789, 2791, 2793, 2795, 2797, 2799, 2801 2803, 2805, 2807,
2809, 2811, 2813, 2815, 2817, 2819, 2821, 2823, 2825, 2827, 2829, 2831, 2833, 2835, 2837, 2839, 2841 2843, 2845,
2847,2849 2851 2853 2855 2857,2859,2861,2863,2865,2867,2869,2871,2873 2873 2877 2879,2881 2883, 2885, 2887, 2889,2891, 2893, 2895, 2897, 2899 2901, 2903, 2905, 2907,2909, 2911, 2913, 2915 2917, 2919, 2921, 2923, 2925, 2927, 2929, 2931, 2933, 2935, 2937, 2939, 2941,2943, 2945, 2947, 2949, 2951, 2953 29D5, 2957, 2959, 2961, 2963, 2965, 2967, 2969, 2971, 2973, 2975, 2977, 2979,2981, 2983,2985, 2987, 2989, 2991 2993, 2995 2997,
2999, 3001,3003,3005,3007,3009, 3011 3013,3015, 3017, 3019,3021,3023, 3025, 3027, 3029 3031, 3033 3035,
3037 3039,3041 3043, 3045, 3047,3049, 3051,3053, 3055 3057,3059, 3061, 3063, 3065, 3067 3069, 3071, 3073, 3075 3077, 3079,3081, 3083, 3085, 3087 3089, 3091, 3093, 3095,3097, 3099, 3101, 3103,3105, 3107, 3109, 3111, 3113,3115, 3117, 3119, 3121, 3123, 3125 3127, 3129,3131, 3133, 3135,3137 3139 3141,3143,3145, 3147,3149, 3151,3153,3155 3157 3159 3161,3163,3165 3167 3169,3171 3173,3173,3177,3179,3181 3183 3185 3187
3189,3191,3193,3195,3197,3199,3201 3203,3205,3207 3209 3211,3213 3215,3217,3219,3221,3223 3225,
3227, 3229, 3231, 3233, 3235, 3237, 3239, 3241, 3243, 3245, 3247, 3249, 3251, 3253 3255, 3257, 3259, 3261, 3263 3265, 3267, 3269, 3271, 3273, 3275, 3277, 3279, 3281, 3283 3285 3287, 3289, 3291 3293, 3295, 3297, 3299 3301 3303,3305,3307 3309, 3311, 3313, 3315,3317, 3319, 332! 3323, 3325 3327 3329 3331,3333, 3335, 3337, 3339, 3341,3343 3345 3347 3349, 3351, 3353,3355 3357, 3359 3361, 3363 3365,3367 3369, 3371, 3373, 3375, 3377,
3379,3381,3383 3385 3387 3389, 3391, 3393,3395, 3397,3399,3401 3403, 3405 3407, 3409, 3411, 3413, 3415,
3417 3419 3421 3423,3425,3427,3429,3431,3433,3435,3437 3439 3441 3443 3445 3447 3449 3451 3453 3455 34D7 3459,3461,3463, 3465, 3467 3469, 3471,3473,3473 3477, 3479, 3481, 3483,3485, 3487, 3489 3491 3493 3495,3497, 3499, 3501, 3503, 3505,3507,3509, 3511, 3513, 3515 3517,3519, 3521, 3523, 3525, 3527 3529, 3531 3533,3535 3537,3539 3541,3543,3545 3547 3549,3551,3553 3555 3557 3D59 3561 3563,3565,3567,
3569 3571 3573 3575, 3577, 3579 3581 3583,3583, 3587 3589 3591 3593 3595 3597 3599 3601, 3603 3605
3607, 3609,3611, 3613, 36i3 3617 3619, 3621,3623 3625, 3627 3629 3631 3633, 3635, 3637, 3639, 3641,3643, 3645 3647 3649, 3651, 3653 3655, 3657, 3659, 3661, 3663, 3665, 3667 3669, 3671, 3673, 3675, 3677, 3679, 3681, 3683 3685, 3687, 3689 3691, 3693, 3693 3697, 3699, 3701,3703, 3705 3707, 3709, 3711, 3713, 3715, 3717, 3719, 3721 3723,3725, 3727,3729, 3731, 3733, 3735, 3737,3739 3741,3743, 3745, 3747, 3749, 3751,3753, 3755, 3757,
3759, 3761 3763, 3765,3767 3769, 3771 3773, 3773,3777 3779, 3781, 3783, 3785, 3787, 3789, 3791, 3793, 3795,
3797 3799, 3801, 3803, 380D, 3807 3809 381!, 3813, 3815, 3817 3819, 3821 3823, 3825, 3827 3829, 3831, 3833 3835, 3837,3839,3841,3843, 3845, 3847 3849, 3851,3853, 3855, 3857, 3859 3861, 3863 3865 3867 3869 3871 3873 3875, 3877, 3879 3881, 3883, 3885, 3887 3889, 3891, 3893, 3895, 3897, 3899, 3901 3903, 3905, 3907, 3909, 3911,3913,3915,3917 3919 3921,3923 3925 3927 3929,3931 3933 3935 3937,3939,3941,3943,3945,3947,
3949 3951, 3953 3953,3957, 3959, 3961, 3963, 3963 3967, 3969, 3971 3973, 3975, 3977, 3979, 3981, 3983, 3985,
3987,3989,3991,3993,3995,3997,3999 4001,4003 4005,4007 4009 4011 4013 4015 4017 4019 4021 4023, 4025, 4027, 4029 4031, 4033, 4035, 4037 4039, 4041, 4043 4045 4047, 4049 4051 4053, 4055 4057 4059, 4061, 4063, 4063, 4067, 4069, 4071, 4073 4075 4077 4079 4081 4083, 4085 4087, 4089 4091, 4093, 4095, 4097, 4099, 4101,4103,4105,4107 4109 4111,4113 4115 4117,4119,4121 4123 4125 4127 4129 4131 4133,4135 4137,
4139,4141,4143,4145,4147 4149 4151 4153,4153,4157 4159 4161 4163 4165 4167 4169,4171,4173 4175
-95-

WO 2005/111066PCT/IB2005/001775
4177, 4179, 4181, 4183, 4185,4187, 4189,4191, 4193, 4195, 4197, 4199, 4201, 4203, 4205, 4207, 4209, 4211, 4213,
4215, 4217, 4219, 4221, 4223, 4225, 4227,4229, 4231, 4233, 4235, 4237, 4239, 424], 4243, 4245, 4247,4249, 4251,
4253, 4255, 4257, 4259, 4261, 4263, 4265,4267, 4269, 4271, 4273, 4275, 4277, 4279, 4281, 4283, 4285, 4287, 4289,
4291, 4293 4295 4297, 4299, 4301 4303,4305, 4307, 4309, 4311, 4313, 4315, 4317, 4319, 4321, 4323 4325 4327
4329, 4331, 4333, 4335 4337 4339, 4341,4343, 4345, 4347, 4349, 4351, 4353, 4355, 4357, 4359, 4361,4363, 4365,
4367, 4369, 4371, 4373, 4375, 4377, 4-t79, 4381, 4383, 4385, 4387, 4389, 4391, 4393, 4395, 4397, 4399, 4401, 4403, 4405, 4407, 4409, 4411, 4413, 4415 4417 4419, 4421, 4423, 4425, 4427, 4429 4431, 4433, 4435 4437, 4439, 4441, 4443, 4445, 4447,4449, 4451, 4453, 4455, 4457,4459,4461, 4463, 4465 4467, 4469, 4471 4473, 4475, 4477, 4479 4481 4483, 4485 4487, 4489, 4491, 4493,4495,4497,4499, 4501, 4503, 4505, 4507, 4509, 4511, 4513, 4515, 4517,
4519, 4521, 4523, 4525, 4527, 4529, 4531, 4533, 4535, 4537, 4539, 4541, 4543, 4545, 4547, 4549, 4551, 4553, 4555,
4557, 4559, 4561, 4563 4565, 4567, 4569,4571,4573,4575, 4577, 4579, 4581, 4583, 4585, 4587, 4589, 4591, 4593, 4595, 4597, 4599 4601, 4603 4605, 4607 4609,4611,4613, 4615, 4617, 4619, 4621, 4623, 4625, 4627,4629,4631, 4633, 4635, 4637,4639, 4641, *643, 4645, 4647,4649,4651, 4653, 4655, 4657, 4659, 4661, 4663, 4665,4667, 4669, 4671,4673,4675,4677 4679,4681 4683,4685,4687,4689,4691 4693 4695,4697 4699 4701,4703 4705,4707,
4709, 4711, 4713,4715 4717 4719, 4721 4723, 4725,4727, 4729, 4731, 4733, 4735, 4737, 4739, 4741 4743 4745
4747, 4749, 4751 4753, 4755, 4757, 4759, 4761,4763, 4765, 4767, 4769, 4771, 4773, 4775, 4777, 4779, 4781, 4783, 4785, 4787,4789, 4791, 4793, 4795, 4797, 4799,4801, 4803, 4805, 4807,4809, 4811, 4813, 4815, 4817,4819, 4821, 4823, 4825, 4827, 4829, 4831, 4833, 4835, 4837, 4839 4841, 4843, 4845 4847 4849, 485], 4853, 4855, 4857, 4859, 4861,4863 4865,4867,4869 4871 4873 4875,4877 4879 4881,4883 4885 4887,4889,4891,4893,4895,4897,
4899, 4901 4903 4905, 4907, 4909, 4911 4913, 4915, 4917, 4919, 4921, 4923, 4925, 4927, 4929, 4931, 4933, 4935,
4937, 4939, 4941, 4943, 4945, 4947, 4949, 4951,4953, 4955, 4957, 4959, 4961, 4963, 4965, 4967, 4969, 4971, 4973 4975, 4977, 4979, 4981, 4983, 4985, 4987,4989 4991 4993, 4995 4997, 4999, 5001, 5003,5005, 5007 5009, 5011, 5013, 5015, 5017, 5019,5021 5023, 5025, 5027,5029 5031, 5033, 5035 5037 5039,5041,5043 5045,3047, 5049, 5051 5053 5055,5057,5059,5061 5063 5065,5067, 5069, 5071, 5073, 5075,5077 and 5079
11 Nucleic acid encoding the polypeptide of any one of claims 1 to 4
12A composition comprising (a) polypeptide antibody and/or nucleic acid of an) preceding claim and (b) a
pharmaceutically acceptable carrier
13The composition of claim 12, further comprising a vaccine adjuvant
14Nucleic acid polypeptide, or antibody of any one of claims I to 11 for use as a medicament
15 A method of treating a patient, comprising administering to the patient a therapeutically effective amount of the composition of claim 12
16The use of nucleic acid, polypeptide, or antibody of any one of claims 1 to 11 in the manufacture of a medicament for
treating or preventing disease and/or infection caused by H.influenzae
17The method of claim 15 or the use of claim 16, for preventing otitis media, bronchitis conjunctivitis, sinusitis, a urinary
tract infection pneumonia bacteremia septic arthritis, epiglotitis, pneumonia, empyema, pericarditis, cellulitis,
osteomyelitis or meningitis
-96-

Indian Patents. 265261:"RECOMBINANTLY PREPARED POLYPEPTIDE FROM H. INFLUENZAE AND COMPOSITION THEREOF" (2024)
Top Articles
Latest Posts
Article information

Author: Kareem Mueller DO

Last Updated:

Views: 5816

Rating: 4.6 / 5 (46 voted)

Reviews: 93% of readers found this page helpful

Author information

Name: Kareem Mueller DO

Birthday: 1997-01-04

Address: Apt. 156 12935 Runolfsdottir Mission, Greenfort, MN 74384-6749

Phone: +16704982844747

Job: Corporate Administration Planner

Hobby: Mountain biking, Jewelry making, Stone skipping, Lacemaking, Knife making, Scrapbooking, Letterboxing

Introduction: My name is Kareem Mueller DO, I am a vivacious, super, thoughtful, excited, handsome, beautiful, combative person who loves writing and wants to share my knowledge and understanding with you.